Amphigerontia bifasciata

(Latreille, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Psocodea/Psocidae/Amphigerontia

At a glance

Occurrence records424

Data sources9

Biological traits0

DNA specimens148

eDNA detections191

Sources9 archives

Databases and archives Amphigerontia bifasciata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI191 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics148 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF424 records

Environmental DNA4 datasets · 4 countries191 detections

DNA & barcodingBOLD148 specimens

Genome at a glanceGoaT · TreeOfSex2n = 18

01Narrative

Amphigerontia bifasciata is a yellowish-black colouredDescription and habitat species of Psocoptera from Psocidae family that can be found in Great Britain and Ireland. They can also be found in Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Hungary, Italy, Latvia, Luxembourg, Norway, Poland, Romania, Sweden, Switzerland, and the Netherlands.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding148 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphigerontia bifasciata has left across the world's sequence archives.

At a glance

DNA specimens148

BINs6

Marker genes1

eDNA detections191

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus135 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 78% of positions are identical in every specimen.

Where individuals differ — all 142 variable positions, in barcode order

1Cmostly conserved

2Cmostly conserved

3Tmostly conserved

4Amostly conserved

6Amostly conserved

7Tmostly conserved

10Tmostly conserved

11Tmostly conserved

12Tmostly conserved

13Amostly conserved

14Tmostly conserved

15Tmostly conserved

16Tmostly conserved

17Gmostly conserved

18Gmostly conserved

19Amostly conserved

20Amostly conserved

21Tmostly conserved

22Cmostly conserved

23Tmostly conserved

24Gmostly conserved

25Amostly conserved

26Gmostly conserved

27Cmostly conserved

28Tmostly conserved

29Gmostly conserved

30Gmostly conserved

31Gmostly conserved

32Amostly conserved

33Tmostly conserved

35Gmostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Gmostly conserved

40Gmostly conserved

41Amostly conserved

42Cmostly conserved

43Tmostly conserved

44Amostly conserved

45Gmostly conserved

46Cvariable

47Cmostly conserved

48Tmostly conserved

50Amostly conserved

51Gmostly conserved

52Amostly conserved

53Amostly conserved

55Amostly conserved

56Tmostly conserved

57Tmostly conserved

58Amostly conserved

59Amostly conserved

60Tmostly conserved

61Tmostly conserved

62Cmostly conserved

63Gmostly conserved

64Tmostly conserved

65Cvariable

66Tmostly conserved

68Gmostly conserved

69Amostly conserved

70Amostly conserved

71Cmostly conserved

72Tmostly conserved

73Amostly conserved

74Gmostly conserved

75Gmostly conserved

76Amostly conserved

78Amostly conserved

79Gmostly conserved

80Cmostly conserved

81Cmostly conserved

82Cmostly conserved

85Tmostly conserved

86Tmostly conserved

92Tmostly conserved

103Cmostly conserved

109Tmostly conserved

124Cvariable

154Tmostly conserved

172Gmostly conserved

202Amostly conserved

211Gmostly conserved

214Tmostly conserved

235Avariable

259Amostly conserved

265Amostly conserved

268Amostly conserved

274Amostly conserved

277Amostly conserved

283Amostly conserved

292Cmostly conserved

304Amostly conserved

307Cmostly conserved

310Gvariable

319Amostly conserved

322Cmostly conserved

325Tmostly conserved

334Tmostly conserved

337Cvariable

340Tmostly conserved

343Cmostly conserved

346Amostly conserved

349Cmostly conserved

364Cvariable

367Cmostly conserved

376Cmostly conserved

379Amostly conserved

385Avariable

400Amostly conserved

427Amostly conserved

448Cmostly conserved

457Cmostly conserved

460Cmostly conserved

466Tmostly conserved

469Gvariable

475Tmostly conserved

476Tvariable

478Avariable

+22 more variable positions not shown

CCTATATTTTTTATTTGGAATCTGAGCTGGGATAGTAGGGACTAGCCTAAGAATATTAATTCGTCTAGAACTAGGACAGCCCGGTTTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.8%

Haplotypes18

BINs6

Most divergent pair12.1%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Longivalvus hyalospilussame family17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Amphigerontia bifasciata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Golub, N., & Nokkala, S. (2009). Chromosome numbers in eight species of Palaearctic Psocoptera (Insecta). Comparative Cytogenetics, 3(1), 33-41. ↗

TreeOfSex · invert — Golub, N. V. (2004). The variability of the chromosome numbers in Psocomorpha (Insecta, Psocoptera). Caryologia, 57(1), 67-71. ↗

2n 173×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type424 records

Wild obs. + sensor191

Museum / vouchered233

Range

Area of Occupancy AOO924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 106≤1 km 34≤10 km 16

156 georeferenced · 35 without coordinates

Open the mapobservation + sensor191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 21≤1 km 5≤10 km 25

51 georeferenced · 182 without coordinates

Open the institutions mapphysical evidence233

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	81
University of Tokyo, Department of Zoologylocation not on record	25
Stockholm, SE	11
Edmonton, CA	10
SLU Artdatabankenlocation not on record	7
San Francisco, US	5
BioFokuslocation not on record	4
University of Guelphlocation not on record	3
Metsähallituslocation not on record	3
ZMAAlocation not on record	2
East Lansing, US	1

11 institutions · 152 of 233 vouchered records shown · 81 without an institution code

09Environmental DNA191 detections

Where the DNA of Amphigerontia bifasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found191

Studies independent surveys4

Countries4

Verifiable raw sequence linked40

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 191 detections have coordinates

Open the map4 countries0

1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland1. Forest|1.2 Subarctic Forest4. Native GrasslandWetlandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 9.70–17.0

Seasonal swing summer↔winter25.4 °C

Max temp (day)16.4 °C 13.9–21.9

Min temp (night)8.60 °C 4.20–13.2

Precipitation92.9 mm/mo 51.9–145

Air humidity58.7 % 55.0–62.6

Moisture balance-11.5 mm/mo -77.7–45.3

Vapour deficit588 Pa 493–791

Wind speed3.30 m/s 2.10–4.60

Cloud cover40.6 % 33.7–57.7

CHELSA 1981–2010, ~9 km grid, at location & month of 188 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)