Amphiestris baetica

(Rambur, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Tettigoniidae/Amphiestris

At a glance

Occurrence records65

Data sources7

Biological traits0

DNA specimens6

eDNA detections1

Sources7 archives

Databases and archives Amphiestris baetica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Amphiestris is een geslacht van rechtvleugeligen uit de familie sabelsprinkhanen (Tettigoniidae). De wetenschappelijke naam van dit geslacht is voor het eerst geldig gepubliceerd in 1853 door Fieber.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiestris baetica has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes2

BINs2

Most divergent pair6.3%

Where individuals differ — all 40 variable positions, in barcode order

4Tmostly conserved

13Cmostly conserved

16Cmostly conserved

22Tmostly conserved

27Gmostly conserved

28Gmostly conserved

31Cmostly conserved

34Amostly conserved

49Tmostly conserved

70Tmostly conserved

82Amostly conserved

84Cmostly conserved

85Tmostly conserved

103Tmostly conserved

115Cmostly conserved

121Amostly conserved

145Amostly conserved

149Amostly conserved

161Gmostly conserved

176Amostly conserved

194Tmostly conserved

199Amostly conserved

214Amostly conserved

243Tmostly conserved

252Tmostly conserved

262Amostly conserved

281Amostly conserved

298Tmostly conserved

307Amostly conserved

331Amostly conserved

382Amostly conserved

383Gmostly conserved

410Gmostly conserved

430Amostly conserved

439Amostly conserved

441Amostly conserved

511Amostly conserved

583Gmostly conserved

615Amostly conserved

631Tmostly conserved

AACTTTATATTTCATCTTTGGTGCTTGGGCCGGAATAGTAGGAACATCTTTAAGCCTACTAATTCGTGCTGAATTAGGACAACCTGGATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Callicrania ramburiisame family16.4%Antaxius kraussiisame family17.0%Neocallicrania bolivariisame family17.0%Synephippius obviussame family17.3%Zeuneriana amplipennissame family17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor63

Museum / vouchered2

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 11≤1 km 2≤10 km 2

15 georeferenced · 48 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	1
Bonn, DE	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Amphiestris baetica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)