Amphiesma stolatum

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Squamata/Colubridae/Amphiesma

At a glance

Occurrence records2 379

Data sources11

Biological traits0

DNA specimens17

eDNA detections23

Sources11 archives

Databases and archives Amphiesma stolatum's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 379 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 379 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈1.5 Gbp

01Narrative

The buff striped keelback (Amphiesma stolatum) is a species of nonvenomous colubrid snake found across Asia. It is the sole species of genus Amphiesma. It is a typically nonaggressive snake that feeds on frogs and toads. It belongs to the subfamily Natricinae, and is closely related to water snakes and grass snakes. It resembles an Asian version of the American garter snake. It is quite a common snake but is rarely seen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiesma stolatum has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes2

eDNA detections23

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

14Cmostly conserved

28Gmostly conserved

46Tmostly conserved

52Avariable

88Gmostly conserved

92Tmostly conserved

103Cmostly conserved

110Amostly conserved

172Cmostly conserved

178Cmostly conserved

217Avariable

263Cmostly conserved

292Gmostly conserved

322Tmostly conserved

400Tmostly conserved

481Gmostly conserved

496Tvariable

502Amostly conserved

538Tmostly conserved

586Cmostly conserved

AACCCTTTACCTCCTGTTTGGCGCATGGTCTGGACTAGTCGGAGCTTGCCTAAGCATCCTTATGCGAATAGAATTAACACAACCCGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes4

BIN1

Most divergent pair0.46%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Fowlea piscatorsame family13.7%Hebius sauterisame family14.6%Lycodon futsingensissame family14.7%Hebius craspedogastersame family15.1%Stenorrhina degenhardtiisame family15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Amphiesma stolatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 495 603 661 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amphiesma stolatum1.5 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Chromosome records36–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×GoaT · Tree of Sex Database · TreeOfSex · vert

GoaT · Tree of Sex Database — ↗

TreeOfSex · vert — Olmo E., Signorino G.G. (2005) ChromoRep: A reptiles chromosomes database. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 379 records

Wild obs. + sensor1 850

Museum / vouchered441

Other88

Origin

Native7

Range

Area of Occupancy AOO5 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 455≤1 km 277≤10 km 127>10 km 130

989 georeferenced · 861 without coordinates

Open the mapobservation + sensor1 850

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 6≤1 km 24≤10 km 87>10 km 42

159 georeferenced · 282 without coordinates

Open the institutions mapphysical evidence441

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	153
Toronto, CA	64
Cambridge, US	54
Berkeley, US	43
Washington, US	31
Wuzhou, CN	16
Natural History Museum, Tribhuvan Universitylocation not on record	12
New Haven, US	11
Bombay Natural History Societylocation not on record	10
Ann Arbor, US	9
Stockholm, SE	8
Chongqing Museumlocation not on record	6
South Kensington, GB	5
National Museum of Natural Sciencelocation not on record	3
Bonn, DE	2
Honolulu, US	2
	2
IGRlocation not on record	1
ASUlocation not on record	1

19 institutions · 433 of 441 vouchered records shown · 8 without an institution code

09Environmental DNA23 detections

Where the DNA of Amphiesma stolatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–19.5

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 15.7–25.0

Min temp (night)3.10 °C 3.10–12.2

Precipitation13.8 mm/mo 13.8–21.8

Air humidity45.7 % 45.7–47.2

Moisture balance-95.2 mm/mo -95.2–-93.3

Vapour deficit827 Pa 827–1,380

Wind speed4.50 m/s 2.20–4.50

Cloud cover24.1 % 22.7–24.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphiesma stolatum

At a glance

Sources11 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 379 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 379 records