Amphichroum maculatum

(Horn, 1883) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Amphichroum

At a glance

Occurrence records182

Data sources5

Biological traits0

DNA specimens30

eDNA detections27

Sources5 archives

Databases and archives Amphichroum maculatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF182 records

Environmental DNA1 datasets · 2 countries27 detections

DNA & barcodingBOLD30 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphichroum maculatum has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections27

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

49Cmostly conserved

50Tmostly conserved

85Avariable

169Tvariable

202Gvariable

212Cmostly conserved

217Amostly conserved

220Amostly conserved

223Tmostly conserved

250Cmostly conserved

266Tmostly conserved

268Amostly conserved

278Tmostly conserved

316Amostly conserved

319Cmostly conserved

322Amostly conserved

343Cvariable

346Tmostly conserved

472Cmostly conserved

547Tmostly conserved

559Tmostly conserved

568Tmostly conserved

616Tmostly conserved

634Tmostly conserved

646Cvariable

AACTCTTTATTTTATTTTTGGTGGCTGAGCTGGTATAGTTGGTACATCCTTAAGAATTTTAATTCGAGCTGAATTAGGAAATCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes17

BIN1

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphichroum canaliculatumsame genus9.0%Acrostiba borealissame family11.9%Argentinomyia laneisame order12.0%Gyrinus maculiventrissame order12.3%Phlaeopterus castaneussame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type182 records

Wild obs. + sensor5

Museum / vouchered177

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 62≤1 km 77≤10 km 30

169 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	169
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2

2 institutions · 171 of 177 vouchered records shown · 6 without an institution code

09Environmental DNA27 detections

Where the DNA of Amphichroum maculatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map2 countries0

thin. 2Â¬â gro.clear cut2nd growth5. Wetlands (inland)Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.40 °C 7.00–10.9

Seasonal swing summer↔winter9.20 °C

Max temp (day)12.7 °C 9.80–15.7

Min temp (night)4.90 °C 4.30–7.20

Precipitation282 mm/mo 82.4–282

Air humidity60.7 % 58.1–63.5

Moisture balance238 mm/mo -20.4–238

Vapour deficit431 Pa 372–551

Wind speed2.20 m/s 2.20–5.20

Cloud cover54.5 % 38.2–54.5

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)