Amphicaryon ernesti

Totton, 1954 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Siphonophorae/Prayidae/Amphicaryon

At a glance

Occurrence records217

Data sources7

Biological traits4

DNA specimens17

eDNA detections17

Sources7 archives

Databases and archives Amphicaryon ernesti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility71 records↗

OBISOcean Biodiversity Information System146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS217 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD17 specimens

01Narrative

Amphicaryon ernesti is een hydroïdpoliep uit de familie Prayidae. De poliep komt uit het geslacht Amphicaryon. Amphicaryon ernesti werd in 1954 voor het eerst wetenschappelijk beschreven door Totton.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max200 m

Depth min0 m

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphicaryon ernesti has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes2

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 123 variable positions, in barcode order

10Tmostly conserved

49Tmostly conserved

67Amostly conserved

190Gmostly conserved

200Amostly conserved

217Gmostly conserved

262Gvariable

266Tmostly conserved

286Amostly conserved

328Gvariable

340Tmostly conserved

373Amostly conserved

415Amostly conserved

482Amostly conserved

483Cmostly conserved

484Tmostly conserved

486Tmostly conserved

487Gmostly conserved

488Gmostly conserved

489Amostly conserved

490Tmostly conserved

491Amostly conserved

493Amostly conserved

494Tmostly conserved

495Tmostly conserved

497Cmostly conserved

498Cmostly conserved

499Tmostly conserved

500Tmostly conserved

501Tmostly conserved

502Amostly conserved

505Tmostly conserved

506Gmostly conserved

509Tmostly conserved

510Gmostly conserved

511Amostly conserved

513Cmostly conserved

515Gmostly conserved

516Tmostly conserved

518Cmostly conserved

520Tmostly conserved

521Amostly conserved

525Cmostly conserved

527Gmostly conserved

529Amostly conserved

530Tmostly conserved

531Tmostly conserved

532Tmostly conserved

535Amostly conserved

546Cmostly conserved

547Tmostly conserved

549Tmostly conserved

550Amostly conserved

551Cmostly conserved

552Cmostly conserved

553Tmostly conserved

554Gmostly conserved

555Tmostly conserved

557Tmostly conserved

559Amostly conserved

560Gmostly conserved

561Cmostly conserved

562Amostly conserved

564Gmostly conserved

567Cmostly conserved

568Tmostly conserved

569Amostly conserved

570Tmostly conserved

571Amostly conserved

573Cmostly conserved

576Tmostly conserved

577Gmostly conserved

578Tmostly conserved

580Amostly conserved

583Amostly conserved

584Amostly conserved

585Cmostly conserved

586Cvariable

587Gmostly conserved

588Amostly conserved

590Amostly conserved

591Gmostly conserved

592Gmostly conserved

594Amostly conserved

595Tmostly conserved

596Tmostly conserved

597Tmostly conserved

599Amostly conserved

600Amostly conserved

603Cmostly conserved

604Amostly conserved

607Tmostly conserved

608Tmostly conserved

609Tmostly conserved

614Gmostly conserved

615Amostly conserved

616Cmostly conserved

617Cmostly conserved

618Cmostly conserved

619Tmostly conserved

620Gmostly conserved

622Gvariable

624Gmostly conserved

625Amostly conserved

631Tmostly conserved

633Amostly conserved

634Cmostly conserved

635Cmostly conserved

636Cmostly conserved

637Tmostly conserved

638Amostly conserved

639Tmostly conserved

640Amostly conserved

641Tmostly conserved

645Amostly conserved

646Tmostly conserved

647Cmostly conserved

649Amostly conserved

652Tmostly conserved

653Tmostly conserved

+3 more variable positions not shown

TACTTTATATTTAATTTTTGGTTTATTTTCAGGTATGATTGGAACAGCTCTTAGTATGTTAATAAGATTAGAATTAACTAATCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.6%

Haplotypes4

BIN1

Most divergent pair2.0%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Marrus orthocannasame order14.1%Bargmannia elongatasame order14.1%Eudendrium capillaresame order14.6%Apolemia uvariasame order14.7%Praya dubiasame family15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type217 records

Wild obs. + sensor161

Museum / vouchered55

Other1

Range

Area of Occupancy AOO688 km²

Depth

0–200 m sunlit119

200–1000 m twilight21

1–4 km midnight6

>4 km abyssal0

median 100 m · max 2 450 m · 146 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 14≤1 km 12

26 georeferenced · 135 without coordinates

Open the mapobservation + sensor161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 17≤1 km 5>10 km 2

24 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	20
Washington, US	9
South Kensington, GB	5
Okinawa Institute for Science and Technologylocation not on record	2
Ciudad de México, MX	2
Barcelona, ES	1
University of California San Diegolocation not on record	1

7 institutions · 40 of 55 vouchered records shown · 13 without an institution code

09Environmental DNA17 detections

Where the DNA of Amphicaryon ernesti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.5 °C 27.2–27.5

Seasonal swing summer↔winter7.30 °C

Max temp (day)28.4 °C 28.1–28.4

Min temp (night)26.6 °C 26.4–26.6

Precipitation181 mm/mo 151–181

Air humidity64.9 % 64.4–64.9

Vapour deficit1,281 Pa 1,281–1,285

Cloud cover34.4 % 32.0–34.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)