Amphiagrion abbreviatum

(Selys, 1876) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Amphiagrion

At a glance

Occurrence records2 275

Data sources10

Biological traits0

DNA specimens16

eDNA detections13

Sources10 archives

Databases and archives Amphiagrion abbreviatum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 275 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 275 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD16 specimens

Genome at a glanceGoaT · TreeOfSex2n = 28

01Narrative

Amphiagrion abbreviatum, the western red damsel, is a species of narrow-winged damselfly in the family Coenagrionidae. It is found in Central America and North America. The IUCN conservation status of Amphiagrion abbreviatum is "LC", least concern, with no immediate threat to the species' survival. The population is stable. The IUCN status was reviewed in 2017. Western red damsel, Amphiagrion abbreviatum

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiagrion abbreviatum has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes2

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes1

BIN1

Where individuals differ — all 53 variable positions, in barcode order

1Gmostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

13Amostly conserved

14Amostly conserved

16Gmostly conserved

17Tmostly conserved

18Tmostly conserved

21Gmostly conserved

22Tmostly conserved

23Gmostly conserved

24Cmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Cmostly conserved

44Amostly conserved

47Gmostly conserved

48Cmostly conserved

49Gmostly conserved

50Tmostly conserved

51Tmostly conserved

52Amostly conserved

54Gmostly conserved

55Tmostly conserved

56Amostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

69Tmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

GACTCTATATTTAATGTTTGGTGCATGAGCAGGAATAGTAGGCACGGCGTTAAGTATATTAATTCGAGTTGAATTAGGACAACCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphiagrion sauciumsame genus2.3%Africallagma quingentumsame family12.2%Africallagma elongatumsame family12.3%Enallagma aspersumsame family12.4%Enallagma traviatumsame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Amphiagrion abbreviatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records28–282n range28median28mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Cruden RW (1968) Chromosome numbers of some North American dragonflies (Odonata). Canadian Journal of Genetics and Cytology 10: 200-214. ↗

2n 272×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type2 275 records

Wild obs. + sensor1 144

Museum / vouchered1 131

Origin

Native25

Range

Area of Occupancy AOO4 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 419≤1 km 157≤10 km 39>10 km 20

635 georeferenced · 509 without coordinates

Open the mapobservation + sensor1 144

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 41≤1 km 96≤10 km 268>10 km 79

484 georeferenced · 647 without coordinates

Open the institutions mapphysical evidence1 131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	273
Washington, US	159
Essig Museum of Entomologylocation not on record	78
UCBMElocation not on record	71
CASlocation not on record	64
San Francisco, US	54
Vancouver, CA	45
Los Angeles, US	25
Champaign, US	24
Toronto, CA	21
East Lansing, US	18
Provo, US	12
New Haven, US	11
Chicago, US	11
Albuquerque, US	7
Cornell University Insect Collectionlocation not on record	6
University Park, US	5
Royal Saskatchewan Museumlocation not on record	4
Truckee, US	4
Royal British Columbia Museumlocation not on record	3
Lubbock, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
University of Alberta Museums (UAM)location not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
St. Paul, US	1
Colorado State Universitylocation not on record	1
Montréal, CA	1

27 institutions · 904 of 1 131 vouchered records shown · 227 without an institution code

09Environmental DNA13 detections

Where the DNA of Amphiagrion abbreviatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Riparian Zone4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.2–19.4

Seasonal swing summer↔winter25.5 °C

Max temp (day)24.5 °C 20.2–26.2

Min temp (night)10.6 °C 5.90–14.1

Precipitation50.8 mm/mo 29.0–90.7

Air humidity52.4 % 49.1–55.1

Moisture balance-55.8 mm/mo -116–-39.6

Vapour deficit841 Pa 747–1,084

Wind speed2.90 m/s 1.40–4.00

Cloud cover38.2 % 27.6–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphiagrion abbreviatum

At a glance

Sources10 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 275 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 275 records