Amphiachyris dracunculoides

(DC.) Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Amphiachyris

At a glance

Occurrence records1 429

Data sources13

Biological traits13

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Amphiachyris dracunculoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 429 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF1 429 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 10

01Narrative

Amphiachyris dracunculoides, commonly called broomweed, is a North American species of flowering plants in the family Asteraceae. It is native to the United States, primarily the southern Great Plains from Missouri to eastern New Mexico. Amphiachyris dracunculoides is a tall annual herb occasionally reaching as much as 200 cm (7 feet) in height. Flowers are yellow, with both ray florets and disc florets. It is found in calcareous areas, and is tolerant of disturbed habitats.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology3

Seed mass0.67 mg

Seed mass max0.67 mg

Seed mass min0.67 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition32 compounds

Compounds documented for Amphiachyris dracunculoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Colensane and Clerodane diterpenoids14

Flavonols6

Labdane diterpenoids4

Flavanones4

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,8S,9R,10S,12R)-9,10,12-trimethyl-9-[2-(5-oxo-2H-furan-3-yl)ethyl]-2-oxatricyclo[6.3.1.04,12]dodec-4-en-3-one	present	LOTUS
(1S,4aR,5R,7R,8aS)-5-[2-(furan-3-yl)ethyl]-7-hydroxy-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(1S,4aR,5R,8aR)-5-[2-(furan-3-yl)ethyl]-6-(hydroxymethyl)-1,4a-dimethyl-2,3,4,5,8,8a-hexahydronaphthalene-1-carboxylic acid	present	LOTUS
(1S,4aR,5R,8aR)-6-(acetyloxymethyl)-5-[2-(furan-3-yl)ethyl]-1,4a-dimethyl-2,3,4,5,8,8a-hexahydronaphthalene-1-carboxylic acid	present	LOTUS
(2S)-2-(3,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	NPASS
(2S)-2-(3,4-dihydroxyphenyl)-5-hydroxy-8-[(Z)-4-hydroxy-3-methylbut-2-enyl]-7-methoxy-2,3-dihydrochromen-4-one	present	NPASS
(2S)-2-(3,4-dihydroxyphenyl)-7-hydroxy-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	NPASS
(2S)-2-(3,4-dihydroxyphenyl)-7-hydroxy-8-[(Z)-4-hydroxy-3-methylbut-2-enyl]-2,3-dihydrochromen-4-one	present	NPASS
(4aS,5R,6S,8aR)-5,6,8a-trimethyl-5-[2-(5-oxo-2H-furan-3-yl)ethyl]-3,4,4a,6,7,8-hexahydronaphthalene-1-carboxylic acid	present	LOTUS
(4aS,7S,8R,8aS)-4,7,8-trimethyl-8-[2-(5-oxo-2H-furan-3-yl)ethyl]-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiachyris dracunculoides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY523840.1 ↗591 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTACAACAACCATGCCTCTTGGCATACCGTTGAAGTGCGGCCTAGAAGGCCCTTT …

Amphiachyris dracunculoides internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Amphiachyris dracunculoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidydiploid inferred

Chromosome records10–102n range10median10mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 103×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Solbrig 1960a

CCDB · book-fedorov — Solbrig et al. 1964

n 51×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — WEEDIN, J. F. & A. M. POWELL. 1980. In Chromosome number reports LXIX. Taxon 29: 716–718.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 429 records

Wild obs. + sensor881

Museum / vouchered548

Origin

Native3

Range

Area of Occupancy AOO4 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 561≤1 km 52≤10 km 32>10 km 37

682 georeferenced · 199 without coordinates

Open the mapobservation + sensor881

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 56≤1 km 91≤10 km 179>10 km 33

359 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence548

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions35 of 52 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	178
Fort Worth, US	96
Austin, US	75
Saint Louis, US	36
Texas Lutheran Universitylocation not on record	26
Lubbock, US	17
Pittsburg, US	14
Chongqing Museumlocation not on record	8
Chadron, US	7
EL PASO, US	6
Emporia, US	6
BAYLUlocation not on record	5
Logan, US	5
Davis, US	5
San Angelo, US	4
Bloomington, US	4
DOI/NPS, Greenbelt Parklocation not on record	4
Riverside, US	4
Chapel Hill, US	4
US	3
Albuquerque, US	2
Montréal, CA	2
Fayetteville, US	2
Phoenix, US	2
Lincoln, US	2
MeiseBGlocation not on record	2
Little Rock, US	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Canadian Department of Agriculturelocation not on record	2
Denton, US	1
Boise, US	1
San Luis Obispo, US	1
Fairfax, US	1
Bronx, US	1
LINUlocation not on record	1
Pomona Collegelocation not on record	1
AUAlocation not on record	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
Tempe, US	1
Denver, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Clemson, US	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Burlington, US	1
China Agricultural Universitylocation not on record	1
CJBGlocation not on record	1
Jackson, US	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Iwate Prefectural Museumlocation not on record	1
Bangkok, TH	1
Flagstaff, US	1
Durango, US	1

52 institutions · 548 of 548 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Amphiachyris dracunculoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphiachyris dracunculoides

At a glance

Sources13 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Compound class profile4 classes

Documented compounds32 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 429 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions35 of 52 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 429 records