Ampharete labrops

Hartman, 1961 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Ampharetidae/Ampharete

At a glance

Occurrence records255

Data sources6

Biological traits2

DNA specimens6

eDNA detections4

Sources6 archives

Databases and archives Ampharete labrops's data was compiled from.

GBIFGlobal Biodiversity Information Facility108 records↗

OBISOcean Biodiversity Information System147 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS255 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD6 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampharete labrops has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

36Gmostly conserved

66Amostly conserved

72Tmostly conserved

93Cmostly conserved

192Tmostly conserved

201Amostly conserved

258Gmostly conserved

279Amostly conserved

327Tmostly conserved

348Tmostly conserved

528Gmostly conserved

639Cvariable

ATTAGGGGGATTTGGGGGGGATTACTTGGAACTATGTTAAGTTTAATTATTCGTGTAGAGCTTGGACAGCCTGGCTCATTTTTAGGTAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes3

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampharete finmarchicasame genus12.9%Ampharete acutifronssame genus14.5%Ampharete undecimasame genus15.3%Sosane wahrbergisame family16.7%Zatsepinia rittichaesame family16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S-D9-D10

animal barcodemarker

08Occurrence & distribution

Record type255 records

Wild obs. + sensor84

Museum / vouchered171

Range

Area of Occupancy AOO560 km²

Depth

0–200 m sunlit114

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 181 m · 114 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 83 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 73≤1 km 6≤10 km 4

83 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	26
CASlocation not on record	24
Instituto de Investigaciones Oceanológicas, Universidad Autónoma de Baja Californialocation not on record	21
Santa Barbara Museum of Natural Historylocation not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
San Nicolás de los Garza, MX	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Tapachula, MX	1
Victoria, CA	1
Washington, US	1
Natural History Museum of Los Angeles Countylocation not on record	1

11 institutions · 92 of 171 vouchered records shown · 15 without an institution code

09Environmental DNA4 detections

Where the DNA of Ampharete labrops was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

marine benthic biome

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 11.3–13.6

Seasonal swing summer↔winter10.4 °C

Max temp (day)16.0 °C 14.8–16.0

Min temp (night)11.7 °C 8.20–11.7

Precipitation139 mm/mo 102–139

Air humidity65.4 % 62.0–65.4

Moisture balance12.8 mm/mo 4.30–12.8

Vapour deficit538 Pa 509–538

Wind speed2.70 m/s 2.70–3.10

Cloud cover37.1 % 37.1–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)