Ampelisca diadema
(A.Costa, 1853) · speciesAt a glance
Occurrence records15 802
Data sources7
Biological traits3
DNA specimens13
eDNA detections12
Sources7 archives
Databases and archives Ampelisca diadema's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 935 records↗
OBISOcean Biodiversity Information System7 867 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics13 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources3 traits
Occurrence & distributionGBIF · OBIS15 802 records
Environmental DNA1 datasets · 3 countries12 detections
DNA & barcodingBOLD13 specimens
01Narrative
Ampelisca diadema is een vlokreeftensoort uit de familie van de Ampeliscidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Costa.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Habitat & environment3
Habitat brackishyes
Habitat saltwateryes
Habitat zonebenthic
05DNA & barcoding13 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampelisca diadema has left across the world's sequence archives.
At a glance
DNA specimens13
BINs5
Marker genes1
eDNA detections12
Countries4
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P658 bp consensus12 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 73% of positions are identical in every specimen.
Where individuals differ — all 176 variable positions, in barcode order
1Tvariable
15Gmostly conserved
16Tmostly conserved
17Tmostly conserved
22Tmostly conserved
25Cmostly conserved
28Amostly conserved
31Tvariable
34Avariable
38Cmostly conserved
40Cvariable
43Cmostly conserved
46Amostly conserved
49Tmostly conserved
64Tmostly conserved
67Amostly conserved
68Cvariable
73Gmostly conserved
74Cmostly conserved
82Amostly conserved
85Tvariable
86Gmostly conserved
87Gmostly conserved
91Tmostly conserved
92Tmostly conserved
94Amostly conserved
97Amostly conserved
100Tvariable
103Tvariable
112Cmostly conserved
115Tmostly conserved
121Amostly conserved
127Amostly conserved
133Gvariable
136Tmostly conserved
139Tmostly conserved
142Cvariable
143Tmostly conserved
145Amostly conserved
154Tmostly conserved
163Tmostly conserved
166Amostly conserved
172Tmostly conserved
178Tmostly conserved
181Gmostly conserved
184Amostly conserved
197Tmostly conserved
199Gmostly conserved
202Tvariable
208Amostly conserved
212Cmostly conserved
214Amostly conserved
217Cvariable
220Tvariable
223Tmostly conserved
226Tmostly conserved
247Cmostly conserved
250Cmostly conserved
259Tmostly conserved
262Amostly conserved
263Cvariable
268Cmostly conserved
271Tmostly conserved
274Tmostly conserved
277Gvariable
278Cmostly conserved
284Cmostly conserved
286Cmostly conserved
289Amostly conserved
290Cmostly conserved
292Tmostly conserved
298Amostly conserved
299Gmostly conserved
302Cvariable
307Tmostly conserved
313Gvariable
316Gmostly conserved
319Amostly conserved
322Amostly conserved
325Avariable
328Cvariable
334Amostly conserved
337Tmostly conserved
340Cmostly conserved
343Cmostly conserved
347Tmostly conserved
352Tvariable
353Gmostly conserved
355Cvariable
358Tmostly conserved
360Cmostly conserved
361Tvariable
364Amostly conserved
367Cvariable
370Amostly conserved
373Amostly conserved
376Tmostly conserved
382Tmostly conserved
385Cvariable
391Cvariable
394Tmostly conserved
397Tmostly conserved
401Cmostly conserved
403Tmostly conserved
406Tmostly conserved
407Tvariable
409Amostly conserved
412Tvariable
415Tvariable
418Tmostly conserved
421Cmostly conserved
427Tmostly conserved
430Gvariable
433Gvariable
436Amostly conserved
439Tmostly conserved
442Tmostly conserved
448Cmostly conserved
457Cvariable
469Tmostly conserved
+56 more variable positions not shown
TACACTTTATTTTTGTTTAGGTGCCTGAGCTGGAATACTCGGCACATCTATAAGAATAATTATTCGACTAGAGCTAATAGGACCTGGTAA …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)8.5%
Haplotypes6
BINs4
Most divergent pair19.0%
OtherEurope
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P
animal barcode
08Occurrence & distribution
Record type15 802 records
Wild obs. + sensor3 966
Museum / vouchered8 791
Other3 045
Origin
Native99
Range
Area of Occupancy AOO10 732 km²
Depth
0–200 m sunlit5 065
200–1000 m twilight103
1–4 km midnight0
>4 km abyssal0
median 24.1 m · max 731.5 m · 5 168 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy99% within 1 km
≤100 m 2 951≤1 km 164≤10 km 38
3 153 georeferenced · 813 without coordinates
Open the mapobservation + sensor3 966
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy93% within 1 km
≤100 m 380≤1 km 46≤10 km 5>10 km 29
460 georeferenced · 8 331 without coordinates
Open the institutions mapphysical evidence8 791
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions8 of 38 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| CEFASlocation not on record | 1 786 |
| NIMRDlocation not on record | 254 |
| 730location not on record | 237 |
| Institut Francais pour l'Etude de la Merlocation not on record | 100 |
| DASSHlocation not on record | 100 |
| Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record | 82 |
| Gothenburg, SE | 65 |
| 486location not on record | 60 |
| Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record | 48 |
| AUTHlocation not on record | 29 |
| Stockholm, SE | 28 |
| Padua universtiy?location not on record | 24 |
| Tromsø, NO | 22 |
| Station Biologique de Roscoff (EDMO:521)location not on record | 15 |
| SLU Artdatabankenlocation not on record | 13 |
| Citadel Hill, GB | 10 |
| RWSlocation not on record | 10 |
| Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record | 10 |
| Bergen, NO | 8 |
| Norwegian Institute of Marine Researchlocation not on record | 8 |
| Institute of Biology of the Southern Seas (IBSS), Ukrainelocation not on record | 7 |
| PNHSlocation not on record | 7 |
| Laboratoria di biologia marina di Triestelocation not on record | 6 |
| South Kensington, GB | 5 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 4 |
| Museum für Naturkunde Berlin (Zoological Collections)location not on record | 3 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 3 |
| Université de Liège Underwater research and oceanographic station (4501)location not on record | 3 |
| Frankfurt am Main | 2 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 2 |
| Israel Oceanographic & Limnological Research, Ltd. The National Institute of Oceanographylocation not on record | 1 |
| NTNU-VMlocation not on record | 1 |
| University of Oslo (UiO)location not on record | 1 |
| MZLUlocation not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393)location not on record | 1 |
| Brussels, BE | 1 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
38 institutions · 2 959 of 8 791 vouchered records shown · 861 without an institution code
09Environmental DNA12 detections
Where the DNA of Ampelisca diadema was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found12
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 12 detections have coordinates
Open the map3 countries0
Hard bottomSoft bottom
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median7.00 °C 7.00–14.5
Seasonal swing summer↔winter14.2 °C
Max temp (day)8.10 °C 8.10–18.1
Min temp (night)6.10 °C 6.10–9.30
Precipitation35.3 mm/mo 35.3–82.3
Air humidity62.8 % 58.4–64.9
Vapour deficit373 Pa 373–722
Cloud cover51.7 % 40.9–65.4
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.