Ampelisca brevicornis
(A.Costa, 1853) · speciesAt a glance
Occurrence records42 070
Data sources7
Biological traits6
DNA specimens29
eDNA detections17
Sources7 archives
Databases and archives Ampelisca brevicornis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility20 859 records↗
OBISOcean Biodiversity Information System21 211 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics29 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources6 traits
Occurrence & distributionGBIF · OBIS42 070 records
Environmental DNA1 datasets · 6 countries17 detections
DNA & barcodingBOLD29 specimens
01Narrative
Het kortsprietbuiskopkreeftje is een gravend vlokreeftje uit de familie buiskopkreeftjes. De wetenschappelijke naam van de soort werd in 1853 voor het eerst geldig gepubliceerd door Oronzio Gabriele Costa. A. brevicornis komt voor in het Belgische deel van de Noordzee.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Life cycle & reproduction1
Max. longevity12 months
Habitat & environment3
Habitat brackishyes
Habitat saltwateryes
Habitat zonebenthic
Other traits2
Depth max9 m
Depth min7 m
05DNA & barcoding29 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampelisca brevicornis has left across the world's sequence archives.
At a glance
DNA specimens29
BINs4
Marker genes4
eDNA detections17
Countries6
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P658 bp consensus20 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.
Where individuals differ — all 131 variable positions, in barcode order
2Amostly conserved
3Cmostly conserved
7Amostly conserved
22Gmostly conserved
29Gmostly conserved
31Cmostly conserved
32Gmostly conserved
37Amostly conserved
38Gmostly conserved
40Gmostly conserved
43Tvariable
49Amostly conserved
58Amostly conserved
67Amostly conserved
70Cvariable
73Gmostly conserved
74Cmostly conserved
76Tmostly conserved
79Amostly conserved
82Amostly conserved
83Gmostly conserved
85Cmostly conserved
88Cmostly conserved
95Gvariable
97Gvariable
100Amostly conserved
103Tmostly conserved
106Cvariable
121Tmostly conserved
130Cmostly conserved
136Cmostly conserved
139Tmostly conserved
160Amostly conserved
166Amostly conserved
178Tmostly conserved
184Gvariable
193Tmostly conserved
200Gmostly conserved
202Gvariable
205Cvariable
206Cmostly conserved
208Tmostly conserved
211Amostly conserved
226Cvariable
229Gmostly conserved
241Tmostly conserved
244Gmostly conserved
262Amostly conserved
265Amostly conserved
268Amostly conserved
274Tmostly conserved
277Cvariable
295Tmostly conserved
301Amostly conserved
302Amostly conserved
304Amostly conserved
307Gmostly conserved
316Tmostly conserved
319Gvariable
322Gvariable
325Tmostly conserved
328Amostly conserved
337Cvariable
340Cmostly conserved
349Amostly conserved
353Gmostly conserved
355Amostly conserved
359Cmostly conserved
361Cvariable
364Tmostly conserved
367Cmostly conserved
369Tmostly conserved
376Tvariable
379Tmostly conserved
382Gmostly conserved
386Tmostly conserved
391Tmostly conserved
400Tmostly conserved
401Cmostly conserved
403Tvariable
407Cmostly conserved
409Tmostly conserved
412Cvariable
415Tmostly conserved
418Amostly conserved
424Tmostly conserved
433Gmostly conserved
448Tmostly conserved
451Amostly conserved
454Avariable
456Tmostly conserved
457Tmostly conserved
463Cmostly conserved
466Amostly conserved
469Tmostly conserved
476Amostly conserved
477Tmostly conserved
478Amostly conserved
479Amostly conserved
483Cmostly conserved
484Amostly conserved
487Amostly conserved
496Cmostly conserved
499Cmostly conserved
500Cvariable
505Cmostly conserved
511Gvariable
514Amostly conserved
526Cmostly conserved
529Cmostly conserved
535Amostly conserved
539Tmostly conserved
541Gvariable
553Gmostly conserved
556Avariable
557Cmostly conserved
559Gmostly conserved
562Amostly conserved
571Tmostly conserved
574Avariable
+11 more variable positions not shown
TACTTTATATTTTTTATTAGGGGCTTGAGCCGGAGTAGTGGGTACTTCAATAAGAATAATTATTCGATTCGAGCTTAGAGGAGCCGGCAA …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)7.4%
Haplotypes12
BINs4
Most divergent pair18.4%
OtherEurope
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P18S18S-5P18S-V4
animal barcoderibosomal
08Occurrence & distribution
Record type42 070 records
Wild obs. + sensor6 691
Museum / vouchered15 224
Other20 155
Origin
Native12
Range
Area of Occupancy AOO15 776 km²
Depth
0–200 m sunlit12 772
200–1000 m twilight112
1–4 km midnight1
>4 km abyssal0
median 14.4 m · max 1 280.2 m · 12 885 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy96% within 1 km
≤100 m 4 343≤1 km 174≤10 km 174>10 km 1
4 692 georeferenced · 1 999 without coordinates
Open the mapobservation + sensor6 691
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy99% within 1 km
≤100 m 953≤1 km 37≤10 km 10>10 km 1
1 001 georeferenced · 14 223 without coordinates
Open the institutions mapphysical evidence15 224
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions11 of 52 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| CEFASlocation not on record | 1 338 |
| 730location not on record | 1 209 |
| Institut Francais pour l'Etude de la Merlocation not on record | 683 |
| RWSlocation not on record | 638 |
| Station Biologique de Roscoff (EDMO:521)location not on record | 547 |
| 486location not on record | 341 |
| Israel Oceanographic & Limnological Research, Ltd. The National Institute of Oceanographylocation not on record | 307 |
| Centro de Investigación y de Estudios Avanzados, Unidad Irapuato, Instituto Politécnico Nacionallocation not on record | 284 |
| National Marine Biodiversity Institute of Korealocation not on record | 240 |
| MZLUlocation not on record | 150 |
| Gothenburg, SE | 125 |
| Stockholm, SE | 88 |
| DASSHlocation not on record | 87 |
| Tromsø, NO | 43 |
| Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record | 38 |
| Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record | 28 |
| Laboratoire d'Océanographie Biologique, Universite de Bordeaxlocation not on record | 17 |
| SLU Artdatabankenlocation not on record | 17 |
| PNHSlocation not on record | 14 |
| Biomorlocation not on record | 13 |
| Plymouth Marine Laboratorylocation not on record | 10 |
| Paris, FR | 10 |
| 630location not on record | 8 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 7 |
| South Kensington, GB | 7 |
| Norwegian Institute of Marine Researchlocation not on record | 6 |
| Citadel Hill, GB | 5 |
| University of Lodz, Dept of Invertebrate Zoology and Hydrobiologylocation not on record | 4 |
| ICESlocation not on record | 4 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 4 |
| NTNU-VMlocation not on record | 3 |
| Brussels, BE | 3 |
| Museum für Naturkunde Berlin (Zoological Collections)location not on record | 3 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 3 |
| RBINS-Scientific Heritagelocation not on record | 3 |
| Washington, US | 2 |
| WMR_IMARESlocation not on record | 2 |
| Bergen, NO | 2 |
| Frankfurt am Main | 2 |
| Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| Goteborg Natural History Museumlocation not on record | 1 |
| Cantablocation not on record | 1 |
| Zoologisches Museum Hamburglocation not on record | 1 |
| CZULElocation not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393)location not on record | 1 |
| Laboratorio di Ecologia del Benthos | Benthos Ecology Laboratorylocation not on record | 1 |
| DIHOlocation not on record | 1 |
| FEMlocation not on record | 1 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
| AUTHlocation not on record | 1 |
| Bergen, NO | 1 |
| Rijkswaterstaatlocation not on record | 1 |
52 institutions · 6 308 of 15 224 vouchered records shown · 2 163 without an institution code
09Environmental DNA17 detections
Where the DNA of Ampelisca brevicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map6 countries0
Subtidal seagrass bed (Z.marina)Clay with gravel and shell gravel
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.6 °C 11.4–17.1
Seasonal swing summer↔winter14.6 °C
Max temp (day)18.0 °C 13.7–18.9
Min temp (night)12.2 °C 9.30–16.0
Precipitation79.4 mm/mo 70.7–87.5
Air humidity63.1 % 58.3–65.0
Moisture balance-25.6 mm/mo -33.1–65.0
Vapour deficit716 Pa 486–782
Wind speed4.80 m/s 2.60–5.20
Cloud cover46.0 % 40.9–49.0
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.