Ampedus quercicola

(Buysson, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records12 799

Data sources6

Biological traits2

DNA specimens58

eDNA detections50

Sources6 archives

Databases and archives Ampedus quercicola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 799 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF12 799 records

Environmental DNA1 datasets · 6 countries50 detections

DNA & barcodingBOLD58 specimens

01Narrative

Ampedus quercicola est une espèce de taupins du genre Ampedus. Cette espèce a été décrite par l'entomologiste français Henri du Buysson en 1887.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)omnivore

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus quercicola has left across the world's sequence archives.

At a glance

DNA specimens58

BINs2

Marker genes2

eDNA detections50

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

7Gmostly conserved

94Gvariable

148Gmostly conserved

160Amostly conserved

262Avariable

274Tmostly conserved

277Cmostly conserved

278Tmostly conserved

283Cvariable

286Tmostly conserved

382Tmostly conserved

394Cvariable

400Avariable

457Avariable

479Avariable

481Tmostly conserved

493Tmostly conserved

631Avariable

634Cmostly conserved

643Avariable

646Cvariable

AACTTTGTACTTTATTTTTGGCGCGTGAGCAGGTATACTAGGAACCTCTCTAAGCCTATTAATCCGTGCCGAATTAGGAAACCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes12

BINs2

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus corsicussame genus5.1%Ampedus cinnabarinussame genus8.2%Ampedus nigricollissame genus8.7%Ampedus behrensisame genus9.0%Ampedus sanguinipennissame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type12 799 records

Wild obs. + sensor8 769

Museum / vouchered925

Cultivated / captive2

Other3 103

Origin

Native879

Range

Area of Occupancy AOO8 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 1 624≤1 km 220≤10 km 5 029>10 km 44

6 917 georeferenced · 1 852 without coordinates

Open the mapobservation + sensor8 769

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 6≤1 km 16≤10 km 844>10 km 7

873 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence925

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	65
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	56
Paro, BT	49
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	36
Bern, CH	17
Fribourg, CH	16
Dhaka, BD	14
Zürich, CH	10
NMOKlocation not on record	9
ZSMlocation not on record	7
Naturmuseum St. Gallenlocation not on record	7
Musee d'Histoire Naturallelocation not on record	6
Salzburg, AT	5
Musee cantonal de zoologie de Lausannelocation not on record	3
Muséum d'histoire naturelle de Lillelocation not on record	2
Naturmuseum Solothurnlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Research Collection of Julien Delnattelocation not on record	2
Copenhagen, DK	2
Paris, FR	1
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
CBDClocation not on record	1
Provincia di Livornolocation not on record	1
University of Sydney, Macleay Museumlocation not on record	1
Office National des Forets, Laboratoire National d'Entomologie Forestierelocation not on record	1
MZLUlocation not on record	1

26 institutions · 317 of 925 vouchered records shown · 608 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA50 detections

Where the DNA of Ampedus quercicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map6 countries0

an KirschbÃ¤umen gesammeltUrbanaus der Strauchschicht geklopfttrockene EichewalderHetraieorganic farm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 7.10–19.4

Seasonal swing summer↔winter17.1 °C

Max temp (day)19.4 °C 10.8–23.5

Min temp (night)10.0 °C 2.90–13.9

Precipitation73.5 mm/mo 48.8–150

Air humidity59.2 % 56.7–61.8

Moisture balance-31.4 mm/mo -74.4–54.8

Vapour deficit734 Pa 369–966

Wind speed3.40 m/s 1.60–4.00

Cloud cover38.1 % 34.3–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ampedus quercicola

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type12 799 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 26 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type12 799 records