Ampedus miniipennis

(LeConte, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records56

Data sources6

Biological traits0

DNA specimens41

eDNA detections37

Sources6 archives

Databases and archives Ampedus miniipennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD41 specimens

01Narrative

Ampedus miniipennis is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door LeConte.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus miniipennis has left across the world's sequence archives.

At a glance

DNA specimens41

BINs1

Marker genes1

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P608 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes2

BIN1

Most divergent pair0.99%

Where individuals differ — all 38 variable positions, in barcode order

33Tmostly conserved

57Amostly conserved

87Gmostly conserved

105Cvariable

156Tvariable

180Gvariable

201Tmostly conserved

270Amostly conserved

277Cvariable

285Amostly conserved

385Cmostly conserved

459Cmostly conserved

528Cmostly conserved

537Tmostly conserved

538Cmostly conserved

540Gmostly conserved

542Tmostly conserved

543Amostly conserved

544Tmostly conserved

545Cmostly conserved

548Tmostly conserved

550Cmostly conserved

551Cmostly conserved

552Amostly conserved

553Gmostly conserved

555Cmostly conserved

556Cmostly conserved

557Tmostly conserved

560Cmostly conserved

561Tmostly conserved

563Gmostly conserved

564Amostly conserved

565Gmostly conserved

566Cmostly conserved

567Amostly conserved

569Tmostly conserved

570Tmostly conserved

572Cmostly conserved

ACTTTATACTTTATCTTTGGTGCATGGGCAGGTATACTAGGAACCTCCCTTAGCCTACTAATCCGCGCTGAATTAGGAAACCCTGGGTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus nigrinussame genus4.3%Ampedus deletussame genus6.1%Ampedus auripessame genus6.2%Ampedus semicinctussame genus8.7%Ampedus phoenicopterussame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type56 records

Wild obs. + sensor1

Museum / vouchered55

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	23
Centre for Biodiversity Genomicslocation not on record	4
Canadian Forest Service, Northern Forestry Centrelocation not on record	2
University of Alberta Museums (UAM)location not on record	1
Lexington, US	1
Royal Saskatchewan Museumlocation not on record	1

6 institutions · 32 of 55 vouchered records shown · 23 without an institution code

09Environmental DNA37 detections

Where the DNA of Ampedus miniipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

Sphagnum bog and spruce-fir1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland | 1.4. Temperate ForestForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 6.40–16.1

Seasonal swing summer↔winter26.1 °C

Max temp (day)15.5 °C 8.70–19.2

Min temp (night)5.90 °C 3.50–14.1

Precipitation103 mm/mo 69.3–133

Air humidity60.6 % 54.0–63.1

Moisture balance-0.4 mm/mo

Vapour deficit587 Pa 384–720

Wind speed3.00 m/s

Cloud cover47.6 % 37.9–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)