Ampedus areolatus

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records432

Data sources7

Biological traits0

DNA specimens49

eDNA detections45

Sources7 archives

Databases and archives Ampedus areolatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility432 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF432 records

Environmental DNA1 datasets · 2 countries45 detections

DNA & barcodingBOLD49 specimens

01Narrative

Ampedus areolatus ist ein Käfer aus der Familie der Schnellkäfer (Elateridae) und der Unterfamilie der Ampedinae. Der Artname areolatus kommt aus dem Lateinischen und bedeutet „mit kleinen ebenen Flächen“.Sigmund Schenkling: Erklärung der wissenschaftlichen Käfernamen

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus areolatus has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

1Amostly conserved

4Cvariable

15Tmostly conserved

17Tmostly conserved

18Tmostly conserved

22Tmostly conserved

26Tmostly conserved

28Gmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

36Tmostly conserved

41Gmostly conserved

43Amostly conserved

44Amostly conserved

45Cmostly conserved

47Tmostly conserved

52Amostly conserved

53Amostly conserved

55Cmostly conserved

56Cmostly conserved

60Tmostly conserved

61Tmostly conserved

62Amostly conserved

64Tmostly conserved

65Cmostly conserved

68Gmostly conserved

69Cmostly conserved

72Amostly conserved

74Cmostly conserved

83Cmostly conserved

84Cmostly conserved

86Gmostly conserved

91Cvariable

100Tmostly conserved

106Tmostly conserved

121Tvariable

145Tvariable

166Avariable

289Tvariable

295Avariable

304Tvariable

316Gvariable

373Amostly conserved

401Cvariable

433Gvariable

457Gmostly conserved

472Tvariable

499Cvariable

523Cmostly conserved

532Amostly conserved

535Avariable

538Amostly conserved

541Tvariable

548Tvariable

592Avariable

640Cvariable

643Gvariable

646Tvariable

AACCTTATACTTCATTTTTGGTGCATGGGCTGGAATACTAGGAACATCCCTAAGCCTTCTTATTCGAGCCGAACTAGGAAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes7

BINs2

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus atripennissame genus12.8%Ampedus tenuistriatussame genus13.8%Brachygonus ruficepssame family14.1%Nipponoelater sieboldisame family14.3%Ampedus pullussame genus14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type432 records

Wild obs. + sensor301

Museum / vouchered131

Range

Area of Occupancy AOO1 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 159≤1 km 51≤10 km 9>10 km 45

264 georeferenced · 37 without coordinates

Open the mapobservation + sensor301

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 5≤1 km 5≤10 km 4>10 km 3

17 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	26
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
University of Guelphlocation not on record	17
Cambridge, US	13
Wuzhou, CN	9
Philadelphia, US	6
St. Paul, US	6
Lexington, US	6
CUlocation not on record	3
University of Central Floridalocation not on record	2
MAJClocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1
East Lansing, US	1

14 institutions · 112 of 131 vouchered records shown · 19 without an institution code

09Environmental DNA45 detections

Where the DNA of Ampedus areolatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

Forest14. Artificial - Terrestrial|14.5 Urban Areas14. Artificial - Terrestrial | 14.2 Pasturel…Mixed habitat1. Forest & WoodlandDunes

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 10.9–18.9

Seasonal swing summer↔winter26.4 °C

Max temp (day)20.8 °C 16.0–23.9

Min temp (night)11.7 °C 6.50–15.2

Precipitation89.8 mm/mo 81.3–116

Air humidity58.5 % 56.1–61.9

Moisture balance-34.1 mm/mo -65.2–11.3

Vapour deficit681 Pa 520–903

Wind speed2.90 m/s 2.40–3.90

Cloud cover44.6 % 41.1–47.7

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)