Amorphophallus maximus

(Engl.) N.E.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Amorphophallus

At a glance

Occurrence records7

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Amorphophallus maximus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF7 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Amorphophallus maximus is a species of subtropical tuberous herbaceous plant found in Tanzania and Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Amorphophallus maximus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Menthane monoterpenoids $ Monocyclic monoterpenoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
Dimethyl disulfide	present	LOTUS
Dimethyl trisulfide	present	LOTUS
Limonene	present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amorphophallus maximus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSKX389807.1 ↗384 bp

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGTATCCTCCAAAGTCCCGACACACTCGCGAACGGTTGACCCCGACCTCTCTCGCCGTCCGT …

Amorphophallus maximus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Amorphophallus maximus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · book-ipcn67-71 · CCDB · araceae

CCDB · book-ipcn67-71 — MARCHANT, C.J. 1971. Chromosome variation in the Araceae III. Kew Bull. 25: 323-329.

CCDB · araceae — Petersen, 1989

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 records

Wild obs. + sensor2

Museum / vouchered5

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	2
Frankfurt am Main	1
Uppsala, SE	1

3 institutions · 4 of 5 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)