Amorbia eccopta

Walsingham, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Amorbia

At a glance

Occurrence records61

Data sources6

Biological traits0

DNA specimens130

eDNA detections129

Sources6 archives

Databases and archives Amorbia eccopta's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI129 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics130 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA1 datasets · 1 countries129 detections

DNA & barcodingBOLD130 specimens

01Narrative

Amorbia eccopta is a species of moth of the family Tortricidae. It is found in Costa Rica, Guatemala and Mexico at altitudes between sea level and 1,600 meters. The length of the forewings is 8.4–9 mm for males and 10-11.5 mm for females. The ground colour of the forewings is straw yellow and the hindwings are also straw yellow. There are multiple generations per year. The larvae feed on Persea americana, Ocotea species, Rosa species, Conostegia xalapensis, Hampea appendiculata, Inga longispica and Inga vera. Full-grown larvae reach a length of about 25 mm. 2007 Phylogenetic relationships, systematics, and biology of the species of Amorbia Clemens (Lepidoptera: Tortricidae: Sparganothini).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding130 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amorbia eccopta has left across the world's sequence archives.

At a glance

DNA specimens130

BINs1

Marker genes1

eDNA detections129

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus128 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

40Amostly conserved

433Amostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTACTAATTCGAGCTGAATTAGGAAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes16

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amorbia rhombobasissame genus7.1%Amorbia osmotrissame genus8.4%Amorbia humerosanasame genus8.5%Amorbia cacaosame genus8.7%Amorbia exustanasame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor1

Museum / vouchered60

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 60 records without

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	51
University of Pennsylvanialocation not on record	3

2 institutions · 54 of 60 vouchered records shown · 6 without an institution code

09Environmental DNA129 detections

Where the DNA of Amorbia eccopta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found129

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 129 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.1–27.4

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.4 °C 26.0–31.9

Min temp (night)21.4 °C 20.2–23.8

Precipitation254 mm/mo 35.5–371

Air humidity69.0 % 62.3–70.7

Moisture balance92.6 mm/mo -122–220

Vapour deficit943 Pa 865–1,357

Wind speed3.80 m/s 2.50–5.60

Cloud cover32.0 % 16.0–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 128 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)