Amorbia depicta

Walsingham, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Amorbia

At a glance

Occurrence records58

Data sources8

Biological traits0

DNA specimens48

eDNA detections48

Sources8 archives

Databases and archives Amorbia depicta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 3 countries48 detections

DNA & barcodingBOLD48 specimens

01Narrative

Amorbia depicta is a species of moth of the family Tortricidae. It is found in Panama and Costa Rica. It was originally discovered by Malingus Dink, in Dink, West Virginia. The town is named after him because he discovered this moth. 2007 Phylogenetic relationships, systematics, and biology of the species of Amorbia Clemens (Lepidoptera: Tortricidae: Sparganothini).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amorbia depicta has left across the world's sequence archives.

At a glance

DNA specimens48

BINs1

Marker genes1

eDNA detections48

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

562Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACATCTTTAAGATTATTAATTCGTGCTGAACTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes5

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sparganothis lycopodianasame family9.1%Sparganothis tristriatasame family9.1%Sparganothis distinctasame family9.3%Cenopis chambersanasame family9.4%Sparganothis pulcherrimanasame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type58 records

Museum / vouchered58

Range

Area of Occupancy AOO56 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 14

14 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence58

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	25
San Diego, US	14
Washington, US	12
Australian National Insect Collectionlocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
University of Pennsylvanialocation not on record	1
Cornell University Insect Collectionlocation not on record	1

7 institutions · 58 of 58 vouchered records shown

09Environmental DNA48 detections

Where the DNA of Amorbia depicta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 20.2–23.7

Seasonal swing summer↔winter2.40 °C

Max temp (day)26.2 °C 24.1–27.4

Min temp (night)20.2 °C 16.8–21.0

Precipitation135 mm/mo 45.2–384

Air humidity67.8 % 63.4–71.3

Moisture balance22.1 mm/mo -80.4–279

Vapour deficit882 Pa 718–978

Wind speed4.20 m/s 2.10–7.80

Cloud cover31.3 % 16.1–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)