Amolops medogensis

Li & Rao, 2005 · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Ranidae/Amolops

At a glance

Occurrence records8

Data sources8

Biological traits2

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Amolops medogensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Amolops medogensis is a species of frog in the family Ranidae, the "true frogs". It is endemic to Mêdog County in southeastern Tibet, China; its range might extend into the adjacent Arunachal Pradesh, India. Common name Medog torrent frog has been proposed for it. Amolops medogensis inhabits large streams and the surrounding rocks at elevations of 700 – above sea level. Individuals have been found on rocks under waterfalls. It is a rare species. The population is considered stable, but it is strongly threatened by Yarang Dam in part of its range. In addition, habitat loss and degradation caused by smallholder farming is a minor threat. The entire known range is within the Yaluzangbudaxiagu National Nature Reserve.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Habitat & environment1

Habitat aquaticyes

Other traits1

Repro larvalyes

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amolops medogensis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P576 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes2

BIN1

Most divergent pair0.17%

Where individuals differ — all 1 variable positions, in barcode order

399Avariable

GGCATGATCGGCACGGCCTTAAGTCTACTCATTCGAGCAGAACTAAGCCAGCCGGGGGCCCTTCTTGGTGATGACCAAATTTATAATGTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amolops viridimaculatussame genus6.8%Amolops granulosussame genus10.1%Amolops tuberodepressussame genus10.1%Amolops mantzorumsame genus10.2%Amolops chayuensissame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 records

Wild obs. + sensor1

Museum / vouchered7

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
CASlocation not on record	7

1 institutions · 7 of 7 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Amolops medogensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)