Amolops aniqiaoensis

Dong, Rao & Lü, 2005 · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Ranidae/Amolops

At a glance

Occurrence records0

Data sources7

Biological traits2

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Amolops aniqiaoensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Amolops aniqiaoensis, commonly known as the Aniqiao torrent frog, is a species of frog in the family Ranidae that is endemic to China. It is only known from the vicinity of its type locality, Aniqiao (阿尼桥) in Mêdog County in the southeast of Tibet. The habitat of Amolops aniqiaoensis is a large stream and the surrounding rocks. The site is located with the Yaluzangbudaxiagu National Nature Reserve, but IUCN considers that habitat loss and degradation due to small-scale farming is a threat to the species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Habitat & environment1

Habitat aquaticyes

Other traits1

Repro larvalyes

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amolops aniqiaoensis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P570 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)1.8%

Haplotypes2

BINs2

Most divergent pair5.4%

Where individuals differ — all 31 variable positions, in barcode order

25Gmostly conserved

52Gmostly conserved

66Cmostly conserved

72Gmostly conserved

105Cmostly conserved

132Tmostly conserved

153Gmostly conserved

159Amostly conserved

160Tmostly conserved

162Gmostly conserved

177Amostly conserved

180Amostly conserved

192Gmostly conserved

201Cmostly conserved

210Cmostly conserved

219Tmostly conserved

267Tmostly conserved

270Amostly conserved

300Tmostly conserved

324Tmostly conserved

366Cmostly conserved

381Tmostly conserved

405Cmostly conserved

408Cmostly conserved

411Cmostly conserved

423Cmostly conserved

432Gmostly conserved

444Cmostly conserved

498Amostly conserved

546Amostly conserved

561Amostly conserved

ATCGGCACAGCCCTAAGCCTACTCGTTCGAGCAGAGCTAAGCCAGCCGGGAGCCCTTCTTGGTGACGACCAGATTTATAATGTAATCGTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amolops nyingchiensissame genus10.2%Amolops iriodessame genus10.3%Amolops tuanjieensissame genus10.9%Amolops bellulussame genus11.0%Amolops mantzorumsame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

09Environmental DNA6 detections

Where the DNA of Amolops aniqiaoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)