Amolita obliqua

Smith, 1903 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amolita

At a glance

Occurrence records265

Data sources7

Biological traits0

DNA specimens24

eDNA detections21

Sources7 archives

Databases and archives Amolita obliqua's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF265 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD24 specimens

01Narrative

Amolita obliqua, the oblique grass moth, is an owlet moth in the family Erebidae. The species was first described by Smith in 1903. It is found in North America. The MONA or Hodges number for Amolita obliqua is 9819.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amolita obliqua has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections21

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

499Cmostly conserved

583Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTGGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes7

BINs2

Most divergent pair9.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amolita sentalissame genus7.4%Leucania phragmitidicolasame order8.5%Amolita fessasame genus8.7%Depressaria irregularissame order9.0%Lophoptera phaeobasissame order9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type265 records

Wild obs. + sensor114

Museum / vouchered151

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 37≤1 km 23≤10 km 4>10 km 10

74 georeferenced · 40 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤1 km 3≤10 km 22>10 km 5

30 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	57
Mississippi State, US	21
New Haven, US	20
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	19
Georgia Museum of Natural Historylocation not on record	7
CUlocation not on record	3
Florida Museum of Natural History, McGuire Center for Lepidoptera and Biodiversitylocation not on record	2
East Lansing, US	2

8 institutions · 131 of 151 vouchered records shown · 20 without an institution code

09Environmental DNA21 detections

Where the DNA of Amolita obliqua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

Other

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 20.0–27.1

Seasonal swing summer↔winter14.1 °C

Max temp (day)31.0 °C 26.2–31.8

Min temp (night)22.2 °C 14.7–23.4

Precipitation182 mm/mo 74.4–238

Air humidity61.6 % 56.8–63.9

Moisture balance29.6 mm/mo -96.3–73.2

Vapour deficit1,263 Pa 1,006–1,371

Wind speed2.20 m/s 1.90–3.70

Cloud cover32.8 % 28.2–38.4

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)