Ammoxenus amphalodes

Dippenaar & Meyer, 1980 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Gnaphosidae/Ammoxenus

At a glance

Occurrence records5

Data sources7

Biological traits55

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Ammoxenus amphalodes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

World Spider Trait DBMasaryk University55 traits · 7 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements7 literature sources55 traits

Occurrence & distributionGBIF5 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Ammoxenus amphalodes est une espèce d'araignées aranéomorphes de la famille des Gnaphosidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár et al. 2018aWolff et al. 2022Wolff et al. 2013Dippenaar-Schoeman et al. 1996aDippenaar-Schoeman & Meyer 1980Petráková et al. 2015Pekár et al. 2012a

Morphometry43

ALE0.08 mm

AME0.09 mm

Abdomen height3.5 mm

Abdomen length4.05 mm

Abdomen width3.9 mm

Body length7 mm

Cephalothorax height1 mm

Cephalothorax length2.06 mm

Cephalothorax width1.85 mm

Chelicerae basal part (paturon) length0.67 mm

Cribellum width0.55 mm

Fang length0.17 mm

Femur I length1.3 mm

Femur I width0.44 mm

Femur II length0.9 mm

Femur III length1.5 mm

Femur IV length1.8 mm

Femur IV width0.64 mm

Leg I length5 mm

Leg II length5.8 mm

Leg III length7.8 mm

Leg IV length8.9 mm

Metatarsus I length1.2 mm

Metatarsus II length0.9 mm

Metatarsus III length1.8 mm

Metatarsus IV length1.8 mm

PLE0.07 mm

PME0.06 mm

Patella I length0.6 mm

Patella II length0.9 mm

Patella III length0.7 mm

Patella IV length0.7 mm

Spinneret PLS1.26 mm

Tarsus I length1.3 mm

Tarsus II length2.2 mm

Tarsus III length2.6 mm

Tarsus IV length2.8 mm

Tibia I length0.6 mm

Tibia I width0.26 mm

Tibia II length0.9 mm

Tibia III length1.2 mm

Tibia IV length1.8 mm

Tibia IV width0.23 mm

Predation6

Hunting guildspecialists

Hunting guild 2ground runner

Paralysis latency♀0.842·♂1.55 mm

Prey OrderIsoptera

Prey diversity1 mm

Web buildingno

Ecology3

Microhabitatsand

Moisture 2dry

Stratumground

Biomechanics1

'Primary mode of locomotionwalking

Anatomy1

Venom gland size0.32 mm

Morphology1

Cribellumabsent

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammoxenus amphalodes has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P673 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 3 variable positions, in barcode order

214Gvariable

295Avariable

673Tvariable

GACTTTATATTTATTATTTGGATCTTGGTCTGCTATGGTAGGAACTGCTATAAGAGTTTTAATTCGTATAGAATTAGGTCAAACTGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nomisia exornatasame family11.6%Gnaphosa parvulasame family11.7%Cesonia bilineatasame family11.9%Heliophanus tribulosussame order12.2%Pronophaea natalicasame order12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type5 records

Wild obs. + sensor3

Museum / vouchered2

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Royal Museum for Central Africalocation not on record	2

1 institutions · 2 of 2 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Ammoxenus amphalodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–24.4

Seasonal swing summer↔winter15.6 °C

Max temp (day)26.6 °C 26.6–31.6

Min temp (night)11.7 °C 11.7–17.3

Precipitation34.5 mm/mo 34.5–58.6

Air humidity48.3 % 48.1–48.3

Moisture balance-98.6 mm/mo -131–-98.6

Vapour deficit1,186 Pa 1,186–1,624

Wind speed2.90 m/s 2.90–3.00

Cloud cover16.3 % 16.3–28.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)