Ammopolia witzenmanni

Standfuss, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Ammopolia

At a glance

Occurrence records1 040

Data sources6

Biological traits0

DNA specimens9

eDNA detections7

Sources6 archives

Databases and archives Ammopolia witzenmanni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 040 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 040 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD9 specimens

01Narrative

Ammopolia witzenmanni is een vlinder uit de familie uilen (Noctuidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1890 door Standfuss. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammopolia witzenmanni has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

19Amostly conserved

55Gmostly conserved

76Tmostly conserved

94Cmostly conserved

121Cmostly conserved

124Gmostly conserved

178Amostly conserved

203Cmostly conserved

214Gmostly conserved

220Amostly conserved

226Avariable

364Tvariable

400Cmostly conserved

409Amostly conserved

418Tmostly conserved

424Cmostly conserved

430Avariable

475Cmostly conserved

476Cmostly conserved

508Amostly conserved

535Gmostly conserved

550Tmostly conserved

559Amostly conserved

628Avariable

646Amostly conserved

ATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACCTCCTTAAGATTGTTAATTCGTGCTGAATTAGGTAATCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes7

BINs2

Most divergent pair3.5%

EuropeAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leucochlaena muscosasame family6.9%Polymixis polymitasame family6.9%Mniotype solierisame family7.0%Trigonophora crassicornissame family7.2%Apamea leucodonsame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 040 records

Wild obs. + sensor567

Museum / vouchered154

Other319

Origin

Native15

Range

Area of Occupancy AOO1 596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 193≤1 km 90≤10 km 61>10 km 4

348 georeferenced · 219 without coordinates

Open the mapobservation + sensor567

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 28≤1 km 2

30 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	120
DABUHlocation not on record	23
UGRlocation not on record	3
European Distributed Institute of Taxonomy (EDIT)location not on record	3
Philadelphia, US	2
Provincia di Livornolocation not on record	1

6 institutions · 152 of 154 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Ammopolia witzenmanni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 7.80–16.7

Seasonal swing summer↔winter17.3 °C

Max temp (day)17.7 °C 12.1–21.3

Min temp (night)10.7 °C 3.10–11.2

Precipitation51.7 mm/mo 41.2–125

Air humidity57.9 % 56.0–62.9

Moisture balance-4.50 mm/mo -38.2–64.2

Vapour deficit601 Pa 449–811

Wind speed2.80 m/s 2.40–3.80

Cloud cover37.0 % 36.4–47.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ammopolia witzenmanni

At a glance

Sources6 archives

At a glance

Record type1 040 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 040 records