Ammodytes marinus

Raitt, 1934 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Ammodytidae/Ammodytes

At a glance

Occurrence records57 166

Data sources11

Biological traits11

DNA specimens51

eDNA detections959

Sources11 archives

Databases and archives Ammodytes marinus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 215 records↗

OBISOcean Biodiversity Information System53 951 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI959 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF · OBIS57 166 records

Environmental DNA7 datasets · 7 countries959 detections

DNA & barcodingBOLD51 specimens

Genome at a glanceGoaT · NCBI≈778 Mbp

01Narrative

Raitt's sandeel (Ammodytes marinus), also known as the lesser sandeel, is a small semi-pelagic ray-finned fish found in the North Atlantic Ocean. The Raitt's sand eel is member of the family Ammodytidae which includes all 31 species of sand eels, often referred to as sand lances. Contrary to their name sand eels, including Raitt's sand eel, are not true eels and instead belong to the order of “weever-like” fishes, the Trachiniformes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology1

Body length25 cm

Life cycle & reproduction3

Age at maturity (male)912 days

Age at sexual maturity912 days

Max. longevity120 months

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max150 m

Depth min10 m

Vulnerability29.72

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammodytes marinus has left across the world's sequence archives.

At a glance

DNA specimens51

BINs2

Marker genes1

eDNA detections959

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

37Gmostly conserved

319Tmostly conserved

334Amostly conserved

469Tmostly conserved

514Gmostly conserved

547Gmostly conserved

CCTTTATCTAGTATTTGGTGCTTGAGCCGCTATGGTGGGGACAGCCCTAAGCCTGCTCATCCGAGCGGAACTTAGCCAACCCGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes16

BINs2

Most divergent pair0.77%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammodytes hexapterussame genus1.7%Hyperoplus immaculatussame family3.5%Ammodytes dubiussame genus3.8%Ammodytes americanussame genus3.8%Ammodytes tobianussame genus4.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ammodytes marinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈777 819 083 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ammodytes marinus0.78 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98% BUSCO

08Occurrence & distribution

Record type57 166 records

Wild obs. + sensor2 941

Museum / vouchered2 058

Other52 167

Range

Area of Occupancy AOO14 468 km²

Depth

0–200 m sunlit51 839

200–1000 m twilight514

1–4 km midnight15

>4 km abyssal0

median 22.2 m · max 1 633.3 m · 52 368 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 133≤1 km 23≤10 km 30>10 km 8

194 georeferenced · 2 747 without coordinates

Open the mapobservation + sensor2 941

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 8≤1 km 12≤10 km 24

44 georeferenced · 2 014 without coordinates

Open the institutions mapphysical evidence2 058

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
RWSlocation not on record	1 227
CEFASlocation not on record	140
Copenhagen, DK	56
Zoologisches Museum Hamburglocation not on record	40
DASSHlocation not on record	19
Frankfurt am Main	17
ICESlocation not on record	14
Bergen, NO	12
FishBaselocation not on record	6
Stockholm, SE	6
Ilvolocation not on record	5
NTNU-VMlocation not on record	3
	3
Vlaams Instituut voor de Zeelocation not on record	3
Geneva, CH	1
Norwegian Institute of Marine Researchlocation not on record	1
Washington, US	1
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	1
PNHSlocation not on record	1

19 institutions · 1 556 of 2 058 vouchered records shown · 108 without an institution code

09Environmental DNA959 detections

Where the DNA of Ammodytes marinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found959

Studies independent surveys7

Countries7

Verifiable raw sequence linked288

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 959 detections have coordinates

Open the map7 countries0

PelagicBottomNorth Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.20 °C -0.8–17.2

Seasonal swing summer↔winter22.3 °C

Max temp (day)12.8 °C 2.40–18.9

Min temp (night)6.00 °C -3.60–15.4

Precipitation132 mm/mo 110–169

Air humidity63.5 % 60.9–68.1

Moisture balance47.2 mm/mo

Vapour deficit433 Pa 216–652

Wind speed4.40 m/s

Cloud cover47.8 % 43.5–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 950 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ammodytes marinus

At a glance

Sources11 archives

Size & morphology1

Life cycle & reproduction3

Habitat & environment3

Uses & economy1

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type57 166 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type57 166 records