Ammocrypta bifascia

Williams, 1975 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Percidae/Ammocrypta

At a glance

Occurrence records789

Data sources8

Biological traits4

DNA specimens29

eDNA detections20

Sources8 archives

Databases and archives Ammocrypta bifascia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility789 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF789 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD29 specimens

01Narrative

The Florida sand darter (Ammocrypta bifascia) is a species of freshwater ray-finned fish, a darter from the subfamily Etheostomatinae, part of the family Percidae, which also contains the perches, ruffes and pikeperches. It is endemic to Gulf Coast drainages from the Aplalachicola to the Perdido River in Florida and southern Alabama. It inhabits streams with waters that are clear to tannin-stained where there are shifting sand bottoms and a moderate to fast flow. It is most frequently encountered where there is a moderate current in medium-sized to large streams, but it will enter smaller streams on occasion. Its appearance is identical to the naked sand darter aside from 2 black bands on each dorsal fin. This species can reach a length of 7.1 cm, though most are only about 4.7 cm in length, at depths of 61 to. The Florida sand darter was first formally described in 1975 by James D. Williams with the type locality given as the Choctawhatchee River, 2.4 km west of Pittman, Florida. This species forms a clade with the naked sand darter (A. beanii) the Western sand darter (A. clara).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length7.7 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammocrypta bifascia has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections20

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P608 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

12Cvariable

21Gvariable

37Tmostly conserved

61Cmostly conserved

75Tmostly conserved

81Cmostly conserved

96Gmostly conserved

99Cmostly conserved

117Cmostly conserved

120Amostly conserved

141Tmostly conserved

147Gmostly conserved

156Amostly conserved

159Tmostly conserved

165Cmostly conserved

168Gmostly conserved

204Gmostly conserved

222Tmostly conserved

234Tmostly conserved

237Tmostly conserved

249Gmostly conserved

255Cmostly conserved

261Tmostly conserved

270Tmostly conserved

297Amostly conserved

300Gmostly conserved

303Cmostly conserved

315Amostly conserved

318Amostly conserved

324Amostly conserved

330Tmostly conserved

339Tmostly conserved

357Tmostly conserved

390Tmostly conserved

399Amostly conserved

465Tmostly conserved

468Tmostly conserved

477Cmostly conserved

483Gmostly conserved

504Gmostly conserved

510Tvariable

525Tmostly conserved

531Tmostly conserved

534Cmostly conserved

537Cmostly conserved

540Cmostly conserved

543Tmostly conserved

564Amostly conserved

594Tmostly conserved

603Tvariable

GTATTTGGTGCCTGAGCCGGGATAGTAGGCACTGCCTTAAGTTTGCTTATCCGGGCAGAACTAAGTCAGCCCGGTGCACTCCTCGGGGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes12

BINs2

Most divergent pair8.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammocrypta beaniisame genus7.2%Ammocrypta meridianasame genus8.9%Ammocrypta pellucidasame genus10.0%Ammocrypta vivaxsame genus11.3%Ammocrypta clarasame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~0.9 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.9 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type789 records

Wild obs. + sensor147

Museum / vouchered642

Origin

Native130

Range

Area of Occupancy AOO948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 5>10 km 3

8 georeferenced · 139 without coordinates

Open the mapobservation + sensor147

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 2≤1 km 2≤10 km 28>10 km 7

39 georeferenced · 603 without coordinates

Open the institutions mapphysical evidence642

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	184
Wuzhou, CN	169
University of Alabamalocation not on record	129
Montgomery, US	48
New Haven, US	34
Champaign, US	6
Washington, US	5
Ann Arbor, US	5
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	2
	1
Texas Cooperative Wildlife Collectionlocation not on record	1

11 institutions · 584 of 642 vouchered records shown · 58 without an institution code

09Environmental DNA20 detections

Where the DNA of Ammocrypta bifascia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 18.7–19.3

Seasonal swing summer↔winter17.8 °C

Max temp (day)25.1 °C 24.5–25.1

Min temp (night)14.5 °C 14.2–14.6

Precipitation122 mm/mo 108–127

Air humidity58.7 % 57.5–58.9

Moisture balance10.0 mm/mo -14.5–15.1

Vapour deficit957 Pa 943–1,002

Wind speed2.60 m/s 2.30–3.10

Cloud cover39.5 % 37.7–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)