Ammalo helops

Cramer, 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Ammalo

At a glance

Occurrence records774

Data sources7

Biological traits0

DNA specimens115

eDNA detections113

Sources7 archives

Databases and archives Ammalo helops's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility774 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI113 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics115 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF774 records

Environmental DNA1 datasets · 8 countries113 detections

DNA & barcodingBOLD115 specimens

01Narrative

Ammalo helops is a moth of the family Erebidae first described by Pieter Cramer in 1775. It is found in Mexico, Guatemala, Costa Rica, Honduras, Panama, Jamaica, Cuba, Haiti, Grenada, Trinidad, Amazonas, Brazil, Venezuela, Suriname, Peru and Colombia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding115 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammalo helops has left across the world's sequence archives.

At a glance

DNA specimens115

BINs8

Marker genes1

eDNA detections113

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus112 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

37Amostly conserved

49Amostly conserved

50Tmostly conserved

56Tmostly conserved

82Cmostly conserved

88Tmostly conserved

106Cvariable

166Gmostly conserved

223Tmostly conserved

232Amostly conserved

235Cmostly conserved

337Tmostly conserved

355Cmostly conserved

361Tvariable

364Amostly conserved

368Gmostly conserved

385Tvariable

386Tmostly conserved

400Tmostly conserved

460Tmostly conserved

505Cmostly conserved

523Tmostly conserved

526Cvariable

550Amostly conserved

562Tmostly conserved

571Cmostly conserved

578Tmostly conserved

619Tmostly conserved

628Gmostly conserved

640Tmostly conserved

643Tmostly conserved

652Tmostly conserved

658Cmostly conserved

AACATTATATTTCATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGTAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes23

BINs8

Most divergent pair4.6%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Elysius pachycerasame family3.6%Halysidota atasame family5.3%Halysidota harrisiisame family5.3%Psychophasma erosasame family5.5%Halysidota fumosasame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type774 records

Wild obs. + sensor413

Museum / vouchered361

Range

Area of Occupancy AOO1 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 176≤1 km 79≤10 km 51>10 km 18

324 georeferenced · 89 without coordinates

Open the mapobservation + sensor413

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 24≤1 km 3≤10 km 8

35 georeferenced · 326 without coordinates

Open the institutions mapphysical evidence361

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	242
The University of the West Indies, Trinidad and Tobagolocation not on record	13
Mississippi State, US	11
New Haven, US	9
Ciudad de México, MX	8
Universidad de Sucre (UniSucre)location not on record	5
Tallinn, EE	4
CZMAlocation not on record	3
PUC-RSlocation not on record	3
Area de Conservacion Guanacastelocation not on record	2
MX	2
Mexico City, MX	1
Zürich, CH	1
Colorado State Universitylocation not on record	1
Chicago, US	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1
South Kensington, GB	1

17 institutions · 308 of 361 vouchered records shown · 53 without an institution code

09Environmental DNA113 detections

Where the DNA of Ammalo helops was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found113

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 113 detections have coordinates

Open the map8 countries0

ForestLowland rainforest1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 20.7–25.9

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.5 °C 24.6–29.3

Min temp (night)21.6 °C 17.5–23.8

Precipitation301 mm/mo 65.5–468

Air humidity70.1 % 64.1–75.5

Moisture balance152 mm/mo -87.3–334

Vapour deficit939 Pa 699–1,144

Wind speed2.10 m/s 1.10–3.90

Cloud cover34.2 % 18.7–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 104 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)