Ameronothrus lineatus

(Thörell, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Sarcoptiformes/Ameronothridae/Ameronothrus

At a glance

Occurrence records157

Data sources7

Biological traits0

DNA specimens10

eDNA detections1 092

Sources7 archives

Databases and archives Ameronothrus lineatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility147 records↗

OBISOcean Biodiversity Information System10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 092 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS157 records

Environmental DNA5 datasets · 4 countries1 092 detections

DNA & barcodingBOLD10 specimens

01Narrative

Ameronothrus lineatus is een mijtensoort uit de familie van de Ameronothridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1871 door Thorell.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ameronothrus lineatus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes2

eDNA detections1 092

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 130 variable positions, in barcode order

4Cmostly conserved

16Tvariable

19Tmostly conserved

31Cmostly conserved

35Gmostly conserved

40Amostly conserved

49Cmostly conserved

52Tmostly conserved

67Amostly conserved

73Gmostly conserved

79Gmostly conserved

91Tmostly conserved

94Amostly conserved

103Cmostly conserved

118Cmostly conserved

127Amostly conserved

133Gmostly conserved

136Cmostly conserved

139Cmostly conserved

145Gmostly conserved

163Gmostly conserved

172Cmostly conserved

187Tmostly conserved

193Tmostly conserved

197Tmostly conserved

214Tvariable

226Cmostly conserved

229Amostly conserved

232Amostly conserved

235Tmostly conserved

241Avariable

244Amostly conserved

253Amostly conserved

256Amostly conserved

259Tmostly conserved

262Amostly conserved

265Tmostly conserved

268Tmostly conserved

271Cmostly conserved

278Tmostly conserved

280Gmostly conserved

281Tmostly conserved

289Cmostly conserved

292Gmostly conserved

295Tmostly conserved

298Cmostly conserved

304Tmostly conserved

307Gmostly conserved

310Gmostly conserved

312Tmostly conserved

316Gmostly conserved

322Amostly conserved

325Tmostly conserved

328Tmostly conserved

331Amostly conserved

340Cmostly conserved

343Cmostly conserved

346Amostly conserved

347Cmostly conserved

349Tmostly conserved

352Tmostly conserved

355Cvariable

357Gmostly conserved

358Cmostly conserved

359Cmostly conserved

370Tmostly conserved

373Gmostly conserved

374Tmostly conserved

379Tmostly conserved

382Amostly conserved

385Tmostly conserved

391Amostly conserved

400Gvariable

403Gmostly conserved

407Tvariable

409Gmostly conserved

412Amostly conserved

421Cmostly conserved

424Tmostly conserved

428Tmostly conserved

430Amostly conserved

433Gmostly conserved

436Amostly conserved

442Tmostly conserved

445Tmostly conserved

448Cmostly conserved

466Gmostly conserved

472Tmostly conserved

475Tmostly conserved

478Amostly conserved

484Tmostly conserved

496Cmostly conserved

499Tmostly conserved

508Gmostly conserved

511Amostly conserved

526Tmostly conserved

532Tmostly conserved

536Cmostly conserved

538Gmostly conserved

539Tmostly conserved

541Amostly conserved

544Tmostly conserved

547Tmostly conserved

548Tmostly conserved

550Amostly conserved

553Amostly conserved

556Cmostly conserved

557Tmostly conserved

562Tmostly conserved

565Gvariable

568Tmostly conserved

571Tmostly conserved

577Amostly conserved

580Tmostly conserved

583Gmostly conserved

586Amostly conserved

592Cmostly conserved

598Tmostly conserved

601Tmostly conserved

607Tmostly conserved

+10 more variable positions not shown

AACCCTGTATTTTATTTTTGGTGCATGAGCCGGTGTGATAGGTTCTGCCCTTAGTGGCCTAATTCGACTTGAGTTAGGGCAGCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.9%

Haplotypes4

BINs3

Most divergent pair1.1%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ameronothrus nigrofemoratussame genus6.1%Chamobates borealissame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type157 records

Wild obs. + sensor7

Museum / vouchered150

Range

Area of Occupancy AOO144 km²

Depth

0–200 m sunlit10

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4.8 m · max 20 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2≤10 km 1

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 90≤1 km 2≤10 km 14>10 km 21

127 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NTNU-VMlocation not on record	52
University of Tokyo, Department of Zoologylocation not on record	45
Universidad de Quintana Roo, Chetumallocation not on record	18
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	12
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2

5 institutions · 129 of 150 vouchered records shown · 11 without an institution code

09Environmental DNA1 092 detections

Where the DNA of Ameronothrus lineatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 092

Studies independent surveys5

Countries4

Verifiable raw sequence linked1 085

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 092 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.60 °C -10.8–11.4

Seasonal swing summer↔winter35.6 °C

Max temp (day)9.60 °C -8.50–15.5

Min temp (night)4.10 °C -13.2–8.80

Precipitation89.4 mm/mo 31.1–116

Air humidity61.7 % 60.8–66.4

Moisture balance48.9 mm/mo

Vapour deficit382 Pa 94.2–521

Wind speed4.70 m/s

Cloud cover51.0 % 48.6–61.0

CHELSA 1981–2010, ~9 km grid, at location & month of 1 092 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)