Ameritella mitchelli

(Dall, 1895) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Cardiida/Tellinidae/Ameritella

At a glance

Occurrence records710

Data sources8

Biological traits5

DNA specimens13

eDNA detections13

Sources8 archives

Databases and archives Ameritella mitchelli's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility175 records↗

OBISOcean Biodiversity Information System535 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS710 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Macoma mitchelli is een tweekleppigensoort uit de familie van de Tellinidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1895 door Dall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length1.9 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max36 m

Depth min0 m

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ameritella mitchelli has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes2

BIN1

Most divergent pair0.92%

Where individuals differ — all 6 variable positions, in barcode order

115Tmostly conserved

343Amostly conserved

379Gmostly conserved

439Tmostly conserved

634Tmostly conserved

640Gmostly conserved

TAGTTTATATTTTCTTTTAGGTTTATGAGGTGGTTTGGTAGGTTTAGTTTATAGAACTATAATACGTACTGAGTTAATACATCCTGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ameritella carpenterisame genus14.0%Fabulina fabulasame family14.8%Quidnipagus palatamsame family15.3%Macoploma yoldiformissame family15.4%Gari tellinellasame order15.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type710 records

Wild obs. + sensor405

Museum / vouchered305

Range

Area of Occupancy AOO1 672 km²

Depth

0–200 m sunlit501

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 18 m · 501 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 403 without coordinates

Open the mapobservation + sensor405

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 6≤10 km 2>10 km 2

10 georeferenced · 295 without coordinates

Open the institutions mapphysical evidence305

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina Museum of Natural Scienceslocation not on record	6
Washington, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Philadelphia, US	3
Cambridge, US	3
Chicago, US	3
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1

8 institutions · 27 of 305 vouchered records shown · 140 without an institution code

09Environmental DNA13 detections

Where the DNA of Ameritella mitchelli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 12.4–21.9

Seasonal swing summer↔winter23.6 °C

Max temp (day)21.2 °C 16.4–24.1

Min temp (night)14.2 °C 8.80–20.2

Precipitation110 mm/mo 95.3–110

Air humidity57.3 % 55.4–59.0

Moisture balance-35.1 mm/mo -67.0–-16.4

Vapour deficit853 Pa 641–1,075

Wind speed4.50 m/s 4.00–4.90

Cloud cover41.0 % 36.4–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)