Americodema nigrolineatum

(Knight, 1923) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Americodema

At a glance

Occurrence records131

Data sources6

Biological traits0

DNA specimens5

eDNA detections6

Sources6 archives

Databases and archives Americodema nigrolineatum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF131 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD5 specimens

01Narrative

Americodema nigrolineatum is a species of plant bug in the family Miridae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Americodema nigrolineatum has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P164 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

2Tvariable

8Tvariable

23Tvariable

26Cvariable

29Avariable

41Cvariable

59Cvariable

77Avariable

98Cvariable

102Avariable

113Avariable

119Tvariable

123Tvariable

131Avariable

137Avariable

143Avariable

161Avariable

TTATACCTATCATAATTGGGGGTTTCGGAAACTGATTAGTCCCACTAATAATTGGAGCCCCTGATATAGCATTCCCACGAATAAATAATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.1%

Haplotypes2

BIN1

Most divergent pair9.8%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type131 records

Wild obs. + sensor107

Museum / vouchered24

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 67≤1 km 19≤10 km 3>10 km 5

94 georeferenced · 13 without coordinates

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 3≤10 km 8

11 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	11
Sam Noble Oklahoma Museum of Natural Historylocation not on record	7
College Station, US	6

3 institutions · 24 of 24 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Americodema nigrolineatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 14.3–19.7

Seasonal swing summer↔winter22.2 °C

Max temp (day)23.2 °C 20.4–26.0

Min temp (night)12.1 °C 9.40–14.8

Precipitation86.2 mm/mo 64.4–108

Air humidity56.2 % 55.2–57.2

Moisture balance-39.5 mm/mo -72.8–-6.20

Vapour deficit863 Pa 740–986

Wind speed3.90 m/s 3.80–4.00

Cloud cover36.8 % 31.4–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)