Ameletus lineatus

Traver, 1932 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Ephemeroptera/Ameletidae/Ameletus

At a glance

Occurrence records202

Data sources7

Biological traits0

DNA specimens89

eDNA detections185

Sources7 archives

Databases and archives Ameletus lineatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility202 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI185 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics89 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF202 records

Environmental DNA1 datasets · 2 countries185 detections

DNA & barcodingBOLD89 specimens

01Narrative

Ameletus lineatus is a species of combmouthed minnow mayfly in the family Ameletidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding89 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ameletus lineatus has left across the world's sequence archives.

At a glance

DNA specimens89

BINs2

Marker genes1

eDNA detections185

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus85 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 67 variable positions, in barcode order

3Gmostly conserved

6Tmostly conserved

9Gmostly conserved

45Tmostly conserved

60Gmostly conserved

66Tmostly conserved

72Cmostly conserved

75Amostly conserved

102Amostly conserved

108Tmostly conserved

111Amostly conserved

114Amostly conserved

135Cmostly conserved

144Tmostly conserved

153Tmostly conserved

162Gmostly conserved

165Gmostly conserved

168Cmostly conserved

178Tmostly conserved

189Gmostly conserved

192Gmostly conserved

204Cmostly conserved

210Amostly conserved

243Amostly conserved

246Amostly conserved

249Gmostly conserved

259Cmostly conserved

264Tmostly conserved

282Cmostly conserved

300Amostly conserved

316Gmostly conserved

321Cmostly conserved

324Amostly conserved

327Cmostly conserved

336Amostly conserved

339Amostly conserved

342Tmostly conserved

345Cmostly conserved

354Amostly conserved

360Tmostly conserved

384Tmostly conserved

393Gmostly conserved

397Amostly conserved

399Tmostly conserved

420Tmostly conserved

423Tmostly conserved

432Tmostly conserved

444Tmostly conserved

471Tmostly conserved

489Amostly conserved

492Amostly conserved

507Cmostly conserved

510Cmostly conserved

513Amostly conserved

519Cmostly conserved

525Tmostly conserved

537Cmostly conserved

543Gmostly conserved

552Tmostly conserved

567Amostly conserved

576Cmostly conserved

582Tmostly conserved

588Amostly conserved

591Tmostly conserved

600Tmostly conserved

606Amostly conserved

618Amostly conserved

GGGGCTTGGGCAGGTATAGTTGGAACTTCTTTAAGCTTACTAATTCGAGCAGAATTAGGGCAACCTGGATCCCTAATTGGAGATGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes7

BINs2

Most divergent pair11.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ameletus janetaesame genus5.3%Ameletus vernalissame genus14.1%Ameletus similiorsame genus14.7%Rachispoda trigonatasame order16.3%Carabus morbillosussame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type202 records

Wild obs. + sensor6

Museum / vouchered196

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 85≤1 km 16≤10 km 48>10 km 6

155 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence196

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	108
Montréal, CA	52
CUlocation not on record	16
United States Environmental Protection Agencylocation not on record	2
Illinois Natural History Surveylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Washington, US	1

7 institutions · 182 of 196 vouchered records shown · 14 without an institution code

09Environmental DNA185 detections

Where the DNA of Ameletus lineatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found185

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 185 detections have coordinates

Open the map2 countries0

Stream

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 4.60–15.0

Seasonal swing summer↔winter24.2 °C

Max temp (day)17.4 °C 9.80–20.2

Min temp (night)6.20 °C -0.4–9.50

Precipitation110 mm/mo 84.8–130

Air humidity57.0 % 54.9–58.7

Moisture balance1.40 mm/mo -16.2–50.7

Vapour deficit613 Pa 366–723

Wind speed3.30 m/s 2.10–4.80

Cloud cover44.6 % 41.1–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 181 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)