Ameles decolor

Charpentier, 1825 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Mantodea/Amelidae/Ameles

At a glance

Occurrence records3 239

Data sources9

Biological traits0

DNA specimens17

eDNA detections7

Sources9 archives

Databases and archives Ameles decolor's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 239 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD17 specimens

01Narrative

Ameles decolor is a species of praying mantis native to the west Mediterranean.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ameles decolor has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections7

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P675 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

46Tmostly conserved

84Amostly conserved

99Tmostly conserved

102Avariable

156Avariable

162Tmostly conserved

198Amostly conserved

225Amostly conserved

354Cmostly conserved

409Cmostly conserved

441Tmostly conserved

471Tmostly conserved

522Tmostly conserved

624Tmostly conserved

647Tmostly conserved

648Cvariable

GATATTGGCACACTTTATTTTATTTTTGGTGCCTGAGCAGGAATATTAGGAACATCTTTAAGAATTTTGATTCGAACAGAACTAGGACAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.65%

Haplotypes5

BIN1

Most divergent pair0.74%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ameles heldreichisame genus5.8%Apteromantis bolivarisame family12.5%Statilia parvasame order12.8%Apteromantis apterasame family12.8%Galinthias amoenasame order13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 239 records

Wild obs. + sensor3 194

Museum / vouchered43

Other2

Origin

Native1

Range

Area of Occupancy AOO7 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 1 165≤1 km 482≤10 km 838>10 km 59

2 544 georeferenced · 650 without coordinates

Open the mapobservation + sensor3 194

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 5≤1 km 1≤10 km 9

15 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	11
MZIANlocation not on record	7
Zoologisches Forschungsmuseum Alexander Koeniglocation not on record	6
Museu Nacional de História Natural e da Ciêncialocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Radicondoli, IT	2
Universita degli Studi Roma Trelocation not on record	1

7 institutions · 33 of 43 vouchered records shown · 10 without an institution code

09Environmental DNA7 detections

Where the DNA of Ameles decolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ameles decolor

At a glance

Sources9 archives

At a glance

Record type3 239 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 239 records