Amelanchier lamarckii

F.G.Schroed. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Amelanchier

At a glance

Occurrence records51 055

Data sources11

Biological traits18

DNA specimens15

eDNA detections10

Sources11 archives

Databases and archives Amelanchier lamarckii's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 055 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources18 traits

Occurrence & distributionGBIF51 055 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB2n = 68

01Narrative

Amelanchier lamarckii, also called juneberry, serviceberry or shadbush, is a large deciduous flowering shrub or small tree in the family Rosaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDATRY

Size & morphology6

Leaf mass95.9 mg

Leaf size316 mm²

⚠ sources differ — TRY: 316 mm² · LEDA: 1 065 mm²

Plant height8.75 m

⚠ sources differ — LEDA: 8.75 m · TRY: 9.64 m

Plant height generative5.5 m

Seed length4.75 mm

Seed mass3.89 mg

Life cycle & reproduction5

Deciduousnessaestival

Dispersal typeanimal

Life spanperennial

Raunkiær life formphanerophyte

Seed number10.25

Habitat & environment2

Growth formtree

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)346 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)11.12 mm²/mg

Other traits1

Diaspore typeaggregate fruit (syncarpous)

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amelanchier lamarckii has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes4

GenBank sequences5

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLMG248735.1 ↗552 bpCanada · 2009

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGCA …

Amelanchier lamarckii voucher CCDB-24915-H06 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Amelanchier lamarckii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 681×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type51 055 records

Wild obs. + sensor49 735

Museum / vouchered787

Cultivated / captive528

Other5

Origin

Native1

Introduced706

Range

Area of Occupancy AOO40 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 9 354≤1 km 4 622≤10 km 20 216>10 km 15

34 207 georeferenced · 15 528 without coordinates

Open the mapobservation + sensor49 735

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 301≤1 km 82≤10 km 11>10 km 17

411 georeferenced · 376 without coordinates

Open the institutions mapphysical evidence787

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 8

8 georeferenced · 520 without coordinates

Open the mapnot free-living528

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	170
DBF-NHMDlocation not on record	83
MeiseBGlocation not on record	49
LDlocation not on record	48
Olocation not on record	43
Görlitz, DE	27
Vancouver, CA	20
Helsinki, FI	16
Oskarshamn, SE	14
KMNlocation not on record	9
Christchurch, NZ	9
South Kensington, GB	8
Salzburg, AT	8
Mlocation not on record	6
BFLlocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
Provincia di Livornolocation not on record	5
Auckland, NZ	5
Uniwersytet Śląski w Katowicachlocation not on record	4
Berlin, DE	4
Karlsruhe, DE	4
Finnish Museum of Natural History, Botanical Museumlocation not on record	3
Naturalis Biodiversity Centerlocation not on record	3
San Sebastián, ES	3
GJOlocation not on record	3
Oulu, FI	3
Tilburg, NL	3
University of British Columbia, Herbariumlocation not on record	3
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	2
Moscow State Universitylocation not on record	2
Bothell, US	2
BSBIlocation not on record	2
Dekalb, US	2
Trondheim, NO	2
Frankfurt am Main	2
John May Museum of Natural Historylocation not on record	2
Rotorua, NZ	2
CJBNlocation not on record	1
University of Birminghamlocation not on record	1
Turku, FI	1
sonstHerblocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
H-AkrKGlocation not on record	1
Stockholm, SE	1
Fulda, DE	1
BRNUlocation not on record	1
TUR-Alocation not on record	1
Bergen, NO	1
Logan, US	1

49 institutions · 593 of 787 vouchered records shown · 193 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Amelanchier lamarckii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

shrubby lakeside in boggy groundwet overgrown shrubby field dominated by Spi…on rotting drift log in tidal swamp

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 9.10–17.0

Seasonal swing summer↔winter15.1 °C

Max temp (day)17.7 °C 12.1–19.3

Min temp (night)11.1 °C 5.90–14.7

Precipitation83.6 mm/mo 74.1–106

Air humidity61.1 % 59.6–64.3

Moisture balance4.50 mm/mo -54.6–41.0

Vapour deficit589 Pa 450–770

Wind speed3.10 m/s 2.30–5.80

Cloud cover44.4 % 41.0–62.5

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amelanchier lamarckii

At a glance

Sources11 archives

Size & morphology6

Life cycle & reproduction5

Habitat & environment2

Physiology & chemistry4

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type51 055 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type51 055 records