Amegilla salviae

(Morawitz, 1876) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records114

Data sources6

Biological traits1

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Amegilla salviae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF114 records

DNA & barcodingBOLD3 specimens

01Narrative

Amegilla salviae es una especie de abeja del género Amegilla, familia Apidae.Amegilla TSN 634005 Sistema Integrado de Información Taxonómica. Consultado el 2 de mayo de 2021.Amegilla Catalogue of Life. Consultado el 2 de mayo de 2021. Fue descrita científicamente por Morawitz en 1876.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)5.91 mm

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla salviae has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P682 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

34Tvariable

355Avariable

415Gvariable

AATAAATTATTTTATTTTTGCTATGTGATCTGGTATAGTAGGATCATCAATAAGGATAATTATTCGAATGGAACTAAGAGTACCGGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes3

BIN1

Most divergent pair0.44%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amegilla albigenasame genus12.8%Amegilla calceiferasame genus13.7%Amegilla paeninsulaesame genus14.0%Amegilla thorogoodisame genus14.3%Amegilla walkerisame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type114 records

Wild obs. + sensor40

Museum / vouchered73

Other1

Origin

Native1

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 8≤1 km 6≤10 km 7>10 km 5

26 georeferenced · 14 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 2≤1 km 9≤10 km 36

47 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	21
Zürich, CH	18
Wuzhou, CN	10
Philadelphia, US	7
Cambridge, US	3
	1

6 institutions · 60 of 73 vouchered records shown · 13 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)