Amegilla aeruginosa

(Smith, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records743

Data sources7

Biological traits0

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Amegilla aeruginosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility743 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF743 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Amegilla sybilae es una especie de abeja del género Amegilla, familia Apidae.Amegilla TSN 634005 Sistema Integrado de Información Taxonómica. Consultado el 2 de mayo de 2021.Amegilla Catalogue of Life. Consultado el 2 de mayo de 2021. Fue descrita científicamente por Rayment en 1944.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla aeruginosa has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

28Gvariable

58Gmostly conserved

82Tmostly conserved

112Amostly conserved

241Avariable

328Amostly conserved

343Gmostly conserved

499Amostly conserved

565Gvariable

TATAATTTATTTTTTGTTTGCTTTGTGGTCAGGAATGGTGGGTTCTTCAATAAGAATGATTATTCGAATTGAATTAAGAATTCCCGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes4

BIN1

Most divergent pair0.61%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amegilla assertasame genus17.5%Amegilla thorogoodisame genus17.5%Amegilla walkerisame genus17.7%Anthophora viduasame family17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type743 records

Wild obs. + sensor113

Museum / vouchered536

Other94

Range

Area of Occupancy AOO1 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 53≤1 km 19≤10 km 6>10 km 10

88 georeferenced · 25 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 2≤1 km 1≤10 km 18>10 km 11

32 georeferenced · 504 without coordinates

Open the institutions mapphysical evidence536

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	254
Natick, US	64
Museum and Art Gallery of the Northern Territorylocation not on record	62
Western Australian Museumlocation not on record	45
Museums Victorialocation not on record	44
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	29
Sydney, AU	23
Cambridge, US	9
Wuzhou, CN	1

9 institutions · 531 of 536 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Amegilla aeruginosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

Native vegetation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 21.9–27.3

Seasonal swing summer↔winter8.10 °C

Max temp (day)29.0 °C 28.5–30.5

Min temp (night)18.9 °C 15.0–24.7

Precipitation15.6 mm/mo 4.30–118

Air humidity50.7 % 42.8–60.1

Moisture balance-128 mm/mo -143–-68.7

Vapour deficit1,537 Pa 1,229–1,672

Wind speed2.90 m/s 2.70–4.00

Cloud cover23.7 % 18.1–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)