Ambophthalmos angustus

(Nelson, 1977) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Psychrolutidae/Ambophthalmos

At a glance

Occurrence records4 001

Data sources7

Biological traits6

DNA specimens11

eDNA detections0

Sources7 archives

Databases and archives Ambophthalmos angustus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 987 records↗

OBISOcean Biodiversity Information System2 014 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS4 001 records

DNA & barcodingBOLD11 specimens

01Narrative

The pale toadfish (Ambophthalmos angustus, previously classified as Neophrynichthys angustusKeith L. Jackson and Joseph S. Nelson, Ambophthalmos, a new genus for "Neophrynichthys" angustus and "Neophrynichthys" magnicirrus, and the systematic interrelationships of the fathead sculpins (Cottoidei, Psychrolutidae), Can. J. Zool. 76(7): 1344–1357 (1998), .) is a fathead sculpin of the family Psychrolutidae, found on the continental shelf around New Zealand, between 250 and 1,000 metres deep. It is up to 30 cm long.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length29 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Other traits3

Depth max629 m

Depth min549 m

Vulnerability25.38

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ambophthalmos angustus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

19Tmostly conserved

38Gmostly conserved

630Amostly conserved

631Tmostly conserved

632Cmostly conserved

634Cmostly conserved

CCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACAGCCTTAAGTCTCCTGATCCGAGCTGAGCTAAGCCAACCCGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psychrolutes macrocephalussame family3.1%Psychrolutes phrictussame family3.2%Cottunculus thomsoniisame family3.4%Cottunculus micropssame family3.5%Psychrolutes microporossame family3.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 001 records

Wild obs. + sensor3 961

Museum / vouchered40

Range

Area of Occupancy AOO7 560 km²

Depth

0–200 m sunlit37

200–1000 m twilight1 903

1–4 km midnight35

>4 km abyssal0

median 503.7 m · max 1 489 m · 1 975 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3 888≤1 km 72>10 km 1

3 961 georeferenced

Open the mapobservation + sensor3 961

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 16

16 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
FishBaselocation not on record	2
Museum of New Zealand Te Papa Tongarewalocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2

3 institutions · 6 of 40 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ambophthalmos angustus

At a glance

Sources7 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Record type4 001 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Record type4 001 records