Amblytylus nasutus

(Kirschbaum, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Amblytylus

At a glance

Occurrence records2 853

Data sources7

Biological traits1

DNA specimens49

eDNA detections275

Sources7 archives

Databases and archives Amblytylus nasutus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 853 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI275 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 853 records

Environmental DNA4 datasets · 6 countries275 detections

DNA & barcodingBOLD49 specimens

01Narrative

Amblytylus nasutus is a species of plant bug in the family Miridae. It is found in Europe, Northern Asia (excluding China), and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (adult)herbivore

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblytylus nasutus has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes1

eDNA detections275

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes2

BIN1

Most divergent pair0.15%

ACTTTATATTTTTTATTCGGAATATGGGCAGGAATATTAGGAACTTCGCTAAGTTGAATCATTCGAATCGAATTAGGTATACCCGGGTCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Asciodema obsoletasame family14.1%Atractotomus miniatussame family14.1%Phytocoris vanduzeeisame family14.7%Phytocoris jucundussame family14.7%Plagiognathus fulvipennissame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 853 records

Wild obs. + sensor2 483

Museum / vouchered287

Cultivated / captive79

Other4

Range

Area of Occupancy AOO6 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 568≤1 km 372≤10 km 1 277>10 km 32

2 249 georeferenced · 234 without coordinates

Open the mapobservation + sensor2 483

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 35≤1 km 28≤10 km 34

97 georeferenced · 190 without coordinates

Open the institutions mapphysical evidence287

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 79 records without

Open the mapnot free-living79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	84
Natural History Museum, Aarhus Denmarklocation not on record	38
Philadelphia, US	26
SLU Artdatabankenlocation not on record	19
University of Guelphlocation not on record	17
University of Guelph, Centre for Biodiversity Genomicslocation not on record	14
Tartu, EE	10
ZSMlocation not on record	7
OSUClocation not on record	4
Cornell University Insect Collectionlocation not on record	4
Champaign, US	4
Adam Mickiewicz University in Poznańlocation not on record	3
UO-CeStuBiolocation not on record	3
NTNU-VMlocation not on record	2
Senckenberg Natural History Collections Dresden, Museum of Zoologylocation not on record	2
Universidad Católica de Manizaleslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

17 institutions · 239 of 287 vouchered records shown · 48 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA275 detections

Where the DNA of Amblytylus nasutus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found275

Studies independent surveys4

Countries6

Verifiable raw sequence linked119

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 275 detections have coordinates

Open the map6 countries0

14. Artificial - Terrestrial|14.1 Arable Landblack fallow areaRiparian ZoneWetland14. Artificial - Terrestrial | 14.2 Pasturel…Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 13.2–17.0

Seasonal swing summer↔winter16.9 °C

Max temp (day)18.2 °C 16.1–20.9

Min temp (night)10.9 °C 9.70–13.3

Precipitation67.8 mm/mo 55.0–88.9

Air humidity60.8 % 58.0–61.5

Moisture balance-53.9 mm/mo -81.1–-27.3

Vapour deficit647 Pa 606–768

Wind speed4.20 m/s 3.00–5.30

Cloud cover41.8 % 38.6–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 275 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amblytylus nasutus

At a glance

Sources7 archives

Diet & foraging1

At a glance

Record type2 853 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions3 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 853 records