Amblytropidia mysteca

(Saussure, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Amblytropidia

At a glance

Occurrence records3 336

Data sources8

Biological traits0

DNA specimens18

eDNA detections15

Sources8 archives

Databases and archives Amblytropidia mysteca's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 336 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD18 specimens

01Narrative

Amblytropidia mysteca, the brown winter grasshopper, is a species of slant-faced grasshopper in the family Acrididae. It is found in Central America and North America. Brown winter grasshopper, Amblytropidia mysteca Brown winter grasshopper, Amblytropidia mysteca

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblytropidia mysteca has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

34Amostly conserved

67Tmostly conserved

92Cmostly conserved

106Cvariable

136Cmostly conserved

166Gmostly conserved

235Cmostly conserved

292Amostly conserved

310Cvariable

312Gmostly conserved

334Avariable

343Cmostly conserved

388Gmostly conserved

412Tmostly conserved

428Tmostly conserved

616Tmostly conserved

TACTTTATATTTTATATTTGGAGCTTGAGCAGGAATAGTAGGAACATCAATAAGAATAATTATTCGTACTGAACTAGGACAACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes6

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eritettix simplexsame family10.6%Acrolophitus hirtipessame family10.8%Bruneria brunneasame family10.9%Psoloessa delicatulasame family11.2%Melanoplus gladstonisame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 336 records

Wild obs. + sensor1 280

Museum / vouchered2 056

Range

Area of Occupancy AOO5 904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 696≤1 km 250≤10 km 59>10 km 70

1 075 georeferenced · 205 without coordinates

Open the mapobservation + sensor1 280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 16≤1 km 115≤10 km 954>10 km 281

1 366 georeferenced · 690 without coordinates

Open the institutions mapphysical evidence2 056

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	254
CUlocation not on record	98
College Station, US	62
University of Alabamalocation not on record	35
University of Central Floridalocation not on record	34
National Biodiversity Institute, Costa Ricalocation not on record	28
	22
Mexico City, MX	16
Champaign, US	15
University of Guelphlocation not on record	12
Colorado State Universitylocation not on record	10
Wuzhou, CN	8
Provo, US	7
Montgomery, US	4
Ciudad de México, MX	1
US	1

16 institutions · 607 of 2 056 vouchered records shown · 1 449 without an institution code

09Environmental DNA15 detections

Where the DNA of Amblytropidia mysteca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 16.5–25.7

Seasonal swing summer↔winter11.4 °C

Max temp (day)25.6 °C 19.2–30.8

Min temp (night)16.5 °C 14.0–22.1

Precipitation95.6 mm/mo 75.0–132

Air humidity58.7 % 56.8–61.0

Moisture balance-50.5 mm/mo -86.1–8.00

Vapour deficit1,024 Pa 751–1,390

Wind speed3.50 m/s 2.50–4.60

Cloud cover35.6 % 27.9–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amblytropidia mysteca

At a glance

Sources8 archives

At a glance

Record type3 336 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 336 records