Amblyteles armatorius

(Forster, 1771) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Amblyteles

At a glance

Occurrence records5 193

Data sources9

Biological traits0

DNA specimens44

eDNA detections75

Sources9 archives

Databases and archives Amblyteles armatorius's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI75 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 193 records

Environmental DNA4 datasets · 12 countries75 detections

DNA & barcodingBOLD44 specimens

Genome at a glanceGoaT · NCBI≈227 Mbp

01Narrative

Amblyteles armatorius is a species of parasitic wasp in the family Ichneumonidae first described by Johann Reinhold Forster in 1771.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyteles armatorius has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes1

eDNA detections75

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

58Gmostly conserved

AATTTTATATTTCATATTTGGCATATGAAGAGGCATAATTGGATCTTCTATAAGTTTGATTATTCGGATAGAATTAGGTAACCCAGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Exephanes ischioxanthussame family10.6%Diphyus gradatoriussame family10.9%Ichneumon lugenssame family11.2%Spilichneumon johansonisame family11.4%Ichneumon sarcitoriussame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amblyteles armatorius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈227 071 211 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Amblyteles armatorius0.23 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness93.4% BUSCO

08Occurrence & distribution

Record type5 193 records

Wild obs. + sensor4 999

Museum / vouchered189

Cultivated / captive3

Other2

Range

Area of Occupancy AOO14 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 2 358≤1 km 918≤10 km 836>10 km 82

4 194 georeferenced · 805 without coordinates

Open the mapobservation + sensor4 999

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 23≤1 km 57≤10 km 53>10 km 1

134 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence189

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	34
NCMGlocation not on record	33
Provincia di Livornolocation not on record	31
SLU Artdatabankenlocation not on record	29
South Kensington, GB	17
Gothenburg, SE	11
Stockholm, SE	7
ZSMlocation not on record	5
Natural History Museum, Londonlocation not on record	5
Bavarian State Collection of Zoologylocation not on record	4
Natural History Museum Rotterdamlocation not on record	3
UGRlocation not on record	2
Philadelphia, US	1
Zürich, CH	1
MRPC, SIZK, ZSMlocation not on record	1
Ugentlocation not on record	1

16 institutions · 185 of 189 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA75 detections

Where the DNA of Amblyteles armatorius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found75

Studies independent surveys4

Countries12

Verifiable raw sequence linked26

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 75 detections have coordinates

Open the map12 countries0

UrbanHetraieorganic farm14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 11.4–18.6

Seasonal swing summer↔winter17.4 °C

Max temp (day)18.2 °C 14.4–22.8

Min temp (night)10.7 °C 7.00–13.7

Precipitation62.5 mm/mo 46.2–105

Air humidity60.5 % 58.1–63.3

Moisture balance-51.6 mm/mo -81.5–19.9

Vapour deficit649 Pa 513–885

Wind speed3.50 m/s 2.10–5.00

Cloud cover41.3 % 34.8–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amblyteles armatorius

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 193 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions5 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 193 records