Amblysellus curtisii

(Fitch, 1851) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Amblysellus

At a glance

Occurrence records672

Data sources5

Biological traits0

DNA specimens15

eDNA detections15

Sources5 archives

Databases and archives Amblysellus curtisii's data was compiled from.

GBIFGlobal Biodiversity Information Facility672 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF672 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD15 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblysellus curtisii has left across the world's sequence archives.

At a glance

DNA specimens15

BINs3

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P664 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

1Cmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

13Tmostly conserved

14Cmostly conserved

15Tmostly conserved

16Amostly conserved

20Gmostly conserved

21Gmostly conserved

22Tmostly conserved

23Amostly conserved

26Tmostly conserved

28Gmostly conserved

29Tmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

38Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

46Amostly conserved

47Amostly conserved

48Tmostly conserved

50Tmostly conserved

54Gmostly conserved

56Amostly conserved

60Tmostly conserved

61Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Gmostly conserved

71Gmostly conserved

72Amostly conserved

74Cmostly conserved

76Amostly conserved

78Cmostly conserved

81Amostly conserved

82Gmostly conserved

83Cmostly conserved

85Tmostly conserved

86Amostly conserved

87Gmostly conserved

88Amostly conserved

89Tmostly conserved

91Cmostly conserved

92Cmostly conserved

93Tmostly conserved

97Tmostly conserved

109Tmostly conserved

151Cmostly conserved

163Tmostly conserved

169Gmostly conserved

194Gmostly conserved

202Amostly conserved

203Cvariable

212Tmostly conserved

232Cmostly conserved

241Tmostly conserved

244Cmostly conserved

253Tmostly conserved

274Amostly conserved

292Gmostly conserved

361Cmostly conserved

484Amostly conserved

493Amostly conserved

CACCTTATATTTTCTATTTGGTATTTGGTCAGGTATAATTGGAATAATATTAAGAATAATTATTCGAGTTGAACTAGCACAGCCTAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes4

BINs3

Most divergent pair0.90%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblysellus dorstisame genus11.0%Deltocephalus artemisiaesame family14.0%Deltocephalus serpentinussame family15.1%Graminella ballisame family15.2%Deltocephalus pulicarissame family15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type672 records

Wild obs. + sensor491

Museum / vouchered181

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 274≤1 km 39≤10 km 18>10 km 59

390 georeferenced · 101 without coordinates

Open the mapobservation + sensor491

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤1 km 37≤10 km 58

95 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	107
University of Guelphlocation not on record	38
University Park, US	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
UDlocation not on record	7
Cambridge, US	1

6 institutions · 169 of 181 vouchered records shown · 12 without an institution code

09Environmental DNA15 detections

Where the DNA of Amblysellus curtisii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

ForestPondTemperate mixed forest14. Artificial - Terrestrial|14.1 Arable Land

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 16.3–20.8

Seasonal swing summer↔winter28.8 °C

Max temp (day)23.5 °C 21.1–25.6

Min temp (night)13.2 °C 12.8–17.1

Precipitation97.2 mm/mo 84.8–103

Air humidity58.9 % 57.6–59.8

Moisture balance-40.1 mm/mo -60.8–-14.1

Vapour deficit858 Pa 753–1,011

Wind speed2.70 m/s 2.60–3.30

Cloud cover43.2 % 39.3–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)