Amblyraja jenseni

(Bigelow & Schroeder, 1950) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rajiformes/Rajidae/Amblyraja

At a glance

Occurrence records505

Data sources10

Biological traits6

DNA specimens42

eDNA detections1

Sources10 archives

Databases and archives Amblyraja jenseni's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility122 records↗

OBISOcean Biodiversity Information System383 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS505 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD42 specimens

01Narrative

Jensen's skate (Amblyraja jenseni), also known as the shortail skate,Orlov, Alexie M, et al. “Deepwater Skates (Rajidae) Collected during the 2004 Cruises of R.V. ‘G.O. Sars’ and ‘M.S. Loran’ in the Mid-Atlantic Ridge Area.” ResearchGate, Jan. 2006. is a poorly known species of fish discovered in 2004 during a study of bottom ichthyofauna aboard the Norwegian RV G.O. Sars, where four species were identified, including A. jensieni.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length74.25 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Other traits3

Depth max3 000 m

Depth min165 m

Vulnerability54

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyraja jenseni has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

156Gmostly conserved

528Cmostly conserved

CTTTACTTAATCTTTGGTGCCTGAGCAGGTATAGTCGGAACTGGCCTAAGTCTCTTAATTCGAGCAGAACTAAGTCAGCCCGGATCACTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyraja radiatasame genus2.3%Rajella bigelowisame family4.1%Rajella fyllaesame family4.5%Rajella bathyphilasame family4.7%Rajella linteasame family4.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type505 records

Wild obs. + sensor379

Museum / vouchered106

Other20

Origin

Native3

Range

Area of Occupancy AOO1 464 km²

Depth

0–200 m sunlit6

200–1000 m twilight104

1–4 km midnight196

>4 km abyssal0

median 1 129.1 m · max 2 544.5 m · 306 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 10>10 km 3

13 georeferenced · 366 without coordinates

Open the mapobservation + sensor379

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 10

12 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The Atlantic reference Centrelocation not on record	28
Cambridge, US	7
Copenhagen, DK	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Zoologisches Museum Hamburglocation not on record	3
Wuzhou, CN	2
Texas Cooperative Wildlife Collectionlocation not on record	2
New Haven, US	1
FishBaselocation not on record	1
Dalhousie Universitylocation not on record	1
UWFClocation not on record	1

11 institutions · 54 of 106 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Amblyraja jenseni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.70 °C 1.70–1.70

Seasonal swing summer↔winter18.8 °C

Max temp (day)2.60 °C

Min temp (night)0.9 °C

Precipitation62.8 mm/mo

Air humidity63.4 %

Vapour deficit252 Pa

Cloud cover58.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)