Amblyraja hyperborea

(Collett, 1879) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rajiformes/Rajidae/Amblyraja

At a glance

Occurrence records5 402

Data sources10

Biological traits7

DNA specimens121

eDNA detections3

Sources10 archives

Databases and archives Amblyraja hyperborea's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 225 records↗

OBISOcean Biodiversity Information System3 177 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics121 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS5 402 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD121 specimens

01Narrative

The Arctic skate (Amblyraja hyperborea) is a species of fish in the family Rajidae. It lives near the seabed between 140 and 2,500 m deep in the Arctic Ocean and waters around Canada and northern and north-western Europe, in the northern Pacific Ocean, and in waters surrounding Antarctica and New Zealand. The Arctic skate is about 1 m long and is gray-brown with large dark spots. Its underside is white with dark patterns. It has thorns in line from back to near the end of its tail. It is oviparous; its eggs are capsules with hard horns on each corner. It eats all sorts of small animals at the bottom of the sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length112 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max2 925 m

Depth min92 m

Vulnerability67.2

05DNA & barcoding121 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyraja hyperborea has left across the world's sequence archives.

At a glance

DNA specimens121

BINs2

Marker genes2

eDNA detections3

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus116 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

7Cmostly conserved

157Gmostly conserved

622Amostly conserved

CCTTTACTTAATCTTTGGTGCCTGAGCAGGTATAGTCGGAACTGGCCTAAGTCTCTTAATTCGAGCAGAACTAAGTCAGCCCGGATCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes8

BINs2

Most divergent pair0.61%

N.AmericaOceaniaOtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyraja radiatasame genus2.3%Rajella bigelowisame family4.1%Rajella fyllaesame family4.4%Rajella bathyphilasame family4.7%Rajella linteasame family4.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND2

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_056291 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type5 402 records

Wild obs. + sensor4 910

Museum / vouchered485

Other7

Origin

Native1

Range

Area of Occupancy AOO8 016 km²

Depth

0–200 m sunlit29

200–1000 m twilight1 282

1–4 km midnight566

>4 km abyssal0

median 806.4 m · max 3 570 m · 1 877 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 333≤1 km 21≤10 km 6>10 km 2

362 georeferenced · 4 548 without coordinates

Open the mapobservation + sensor4 910

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 22≤1 km 56≤10 km 1>10 km 118

197 georeferenced · 288 without coordinates

Open the institutions mapphysical evidence485

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	121
Bergen, NO	111
Australian National Fish Collectionlocation not on record	54
Zoologisches Museum Hamburglocation not on record	19
The Atlantic reference Centrelocation not on record	14
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	9
Norwegian Institute of Marine Researchlocation not on record	6
Royal British Columbia Museumlocation not on record	3
South Kensington, GB	3
University of California San Diegolocation not on record	2
Cambridge, US	1
Dalhousie Universitylocation not on record	1
Stockholm, SE	1
CASlocation not on record	1
NTNU-VMlocation not on record	1
Toronto, CA	1
Washington, US	1
ICESlocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1
NHMOlocation not on record	1
ArcODlocation not on record	1
Edmonton, CA	1
Texas Cooperative Wildlife Collectionlocation not on record	1

23 institutions · 355 of 485 vouchered records shown · 13 without an institution code

09Environmental DNA3 detections

Where the DNA of Amblyraja hyperborea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.20 °C -2.20–-2.20

Seasonal swing summer↔winter28.8 °C

Max temp (day)-1.30 °C

Min temp (night)-3.00 °C

Precipitation27.3 mm/mo

Air humidity60.8 %

Vapour deficit204 Pa

Cloud cover57.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amblyraja hyperborea

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type5 402 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 402 records