Amblyraja georgiana

(Norman, 1938) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rajiformes/Rajidae/Amblyraja

At a glance

Occurrence records1 875

Data sources9

Biological traits7

DNA specimens19

eDNA detections1

Sources9 archives

Databases and archives Amblyraja georgiana's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

OBISOcean Biodiversity Information System1 799 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS1 875 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD19 specimens

01Narrative

The Antarctic starry skate (Amblyraja georgiana) is a species of fish in the family Rajidae. It lives near the seabed in depths ranging from 20 to 350 m in the south-eastern Pacific near Chile and South Georgia Island. Its maximum length is 1 m. It produces oblong egg capsules that have four sharp thorns in each corner and measure 116.5 mm long and 80.0 mm wide

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length115 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importancesubsistence fisheries

Other traits3

Depth max350 m

Depth min20 m

Vulnerability69

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyraja georgiana has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

337Tmostly conserved

622Amostly conserved

628Amostly conserved

CCTTTACTTAATCTTTGGTGCCTGAGCAGGTATAGTCGGAACTGGCCTAAGTCTCTTAATTCGAGCAGAACTAAGTCAGCCCGGATCACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyraja radiatasame genus2.5%Rajella bigelowisame family4.3%Rajella bathyphilasame family4.5%Rajella fyllaesame family4.6%Rajella dissimilissame family4.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_037974 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 875 records

Wild obs. + sensor49

Museum / vouchered1 824

Other2

Origin

Native4

Range

Area of Occupancy AOO1 540 km²

Depth

0–200 m sunlit1

200–1000 m twilight28

1–4 km midnight138

>4 km abyssal0

median 1 587 m · max 2 000 m · 167 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 12≤1 km 32≤10 km 1

45 georeferenced · 4 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 1 820 without coordinates

Open the institutions mapphysical evidence1 824

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zoologisches Museum Hamburglocation not on record	20
FishBaselocation not on record	7
New Haven, US	5
Texas Cooperative Wildlife Collectionlocation not on record	4
Australian National Fish Collectionlocation not on record	4
Washington, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Instituto Nacional de Investigacion y Desarrollo Pesquerolocation not on record	2
South African Institute for Aquatic Biodiversitylocation not on record	1

9 institutions · 48 of 1 824 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Amblyraja georgiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amblyraja georgiana

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type1 875 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 875 records