Amblypelta lutescens

(Distant, 1911) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Coreidae/Amblypelta

At a glance

Occurrence records164

Data sources6

Biological traits0

DNA specimens13

eDNA detections13

Sources6 archives

Databases and archives Amblypelta lutescens's data was compiled from.

GBIFGlobal Biodiversity Information Facility164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF164 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD13 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblypelta lutescens has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

60Cmostly conserved

216Tmostly conserved

228Cmostly conserved

276Gmostly conserved

321Tmostly conserved

336Cmostly conserved

339Tmostly conserved

360Cvariable

414Tmostly conserved

424Cmostly conserved

474Amostly conserved

492Gmostly conserved

510Amostly conserved

TTATATTTCATTTTTGGAATGTGATCTGGTATAGTAGGTTCATCTATAAGATGAATTATCCGAGTAGAACTTGGTCAACCAGGATCATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes6

BIN1

Most divergent pair1.5%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dysdercus lunulatussame order12.6%Mozena arizonensissame family13.2%Mozena obtusasame family13.4%Leptocoris mitellatussame order14.1%Dysdercus cingulatussame order14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type164 records

Wild obs. + sensor164

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 68≤1 km 26≤10 km 11>10 km 27

132 georeferenced · 32 without coordinates

Open the mapobservation + sensor164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA13 detections

Where the DNA of Amblypelta lutescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 19.8–27.5

Seasonal swing summer↔winter7.90 °C

Max temp (day)27.9 °C 23.3–30.1

Min temp (night)21.9 °C 16.2–24.9

Precipitation28.2 mm/mo 19.7–286

Air humidity57.6 % 56.8–61.9

Moisture balance-73.9 mm/mo -132–117

Vapour deficit1,298 Pa 995–1,421

Wind speed2.70 m/s 2.60–2.90

Cloud cover31.9 % 25.3–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)