Amblyosyllis finmarchica

(Malmgren, 1867) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Phyllodocida/Syllidae/Amblyosyllis

At a glance

Occurrence records53

Data sources6

Biological traits3

DNA specimens10

eDNA detections167

Sources6 archives

Databases and archives Amblyosyllis finmarchica's data was compiled from.

GBIFGlobal Biodiversity Information Facility32 records↗

OBISOcean Biodiversity Information System21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI167 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS53 records

Environmental DNA3 datasets · 3 countries167 detections

DNA & barcodingBOLD10 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth min52 m

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyosyllis finmarchica has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes3

eDNA detections167

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P662 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 5 variable positions, in barcode order

102Gmostly conserved

103Amostly conserved

477Gmostly conserved

627Amostly conserved

639Tmostly conserved

GGAACTTTATATTTTATTTTTGGTACCTGATCTGGCCTACTGGGGACATCTATAAGACTCCTAATTCGAGCTGAGCTGGGACAACCGGGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P28S-D9-D10

animal barcoderibosomalmarker

08Occurrence & distribution

Record type53 records

Wild obs. + sensor11

Museum / vouchered30

Other12

Range

Area of Occupancy AOO96 km²

Depth

0–200 m sunlit10

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 24.9 m · max 365 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 8 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	9
The Atlantic reference Centrelocation not on record	1
Norwegian Institute of Marine Researchlocation not on record	1

3 institutions · 11 of 30 vouchered records shown · 10 without an institution code

09Environmental DNA167 detections

Where the DNA of Amblyosyllis finmarchica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found167

Studies independent surveys3

Countries3

Verifiable raw sequence linked158

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 167 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.20 °C -5.30–18.5

Seasonal swing summer↔winter22.7 °C

Max temp (day)8.80 °C -1.40–22.4

Min temp (night)2.70 °C -8.90–16.1

Precipitation107 mm/mo 89.3–130

Air humidity60.9 % 59.7–65.7

Moisture balance56.1 mm/mo -42.2–91.8

Vapour deficit345 Pa 165–788

Wind speed5.10 m/s 3.90–6.00

Cloud cover54.1 % 45.9–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 164 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)