Amblyolepis setigera

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Amblyolepis

At a glance

Occurrence records1 467

Data sources10

Biological traits11

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Amblyolepis setigera's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 467 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF1 467 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Amblyolepis is a genus of flowering plants in the daisy family described as a genus in 1836.Candolle, Augustin Pyramus de. 1836. Prodromus Systematis Naturalis Regni Vegetabilis 5: 667–668 in LatinTropicos, Amblyolepis DC. There is only one known species, Amblyolepis setigera, the Huisache daisy,US Department of Agriculture plants profile native to TexasBiota of North America Program 2013 county distribution map and northeastern Mexico (Tamaulipas, Nuevo León, Coahuila).Turner, B. L. 2013. The comps of Mexico. A systematic account of the family Asteraceae (chapter 11: tribe Helenieae). Phytologia Memoirs 16: 1–100Bierner, M. W. 1990. Present status of Amblyolepis (Asteraceae: Heliantheae). Madroño 37: 133–140.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass3.4 mg

Seed mass max3.4 mg

Seed mass min3.4 mg

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyolepis setigera has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF229281.1 ↗645 bp

ACGT

TCGAACCCTGCATGGCAGAACAACCTGTGAACAAGTACCAACAACATGGTTTCTCTGGCTTCAGGCTTTTGGTTTGATGCTCGTGAGGCC …

Amblyolepis setigera internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Amblyolepis setigera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · book-fedorov

CCDB · book-fedorov — Turner 1959a

CCDB · book-fedorov — Raven, Kyhos 1961

n 192×CCDB · ipcn-api-dl · CCDB · Cave1959

CCDB · ipcn-api-dl — Turner, B. L. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.

CCDB · Cave1959 — Turner 1959a.

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HARMS, L.J. 1969. Documented plant chromosome numbers 1969: 3. Sida 3:356-357.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 467 records

Wild obs. + sensor1 101

Museum / vouchered364

Other2

Range

Area of Occupancy AOO2 912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 689≤1 km 131≤10 km 32>10 km 89

941 georeferenced · 160 without coordinates

Open the mapobservation + sensor1 101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 19≤1 km 55≤10 km 127>10 km 22

223 georeferenced · 141 without coordinates

Open the institutions mapphysical evidence364

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	122
Fort Worth, US	72
Bronx, US	50
Lubbock, US	27
Wuzhou, CN	13
San Angelo, US	10
Riverside, US	6
Stephenville, US	6
Saint Louis, US	5
ASUlocation not on record	5
EL PASO, US	5
Mexico City, MX	4
Burlington, US	4
Bloomington, US	3
Austin, US	3
Davis, US	3
CJBGlocation not on record	2
Tlalnepantla, MX	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
San Luis Obispo, US	2
Bangkok, TH	2
Chapel Hill, US	1
Denver, US	1
Stockholm, SE	1
Denton, US	1
Emporia, US	1
Oskarshamn, SE	1
Boise, US	1
Pittsburg, US	1
Wlocation not on record	1
Flagstaff, US	1
Philadelphia, US	1
Texas Lutheran Universitylocation not on record	1

35 institutions · 364 of 364 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Amblyolepis setigera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 467 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions28 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 467 records