Amblyjoppa fuscipennis

(Wesmael, 1845) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Amblyjoppa

At a glance

Occurrence records623

Data sources9

Biological traits0

DNA specimens20

eDNA detections1

Sources9 archives

Databases and archives Amblyjoppa fuscipennis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility623 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF623 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD20 specimens

Genome at a glanceGoaT · NCBI≈279 Mbp

01Narrative

Amblyjoppa fuscipennis is a species of the parasitic wasp in the family Ichneumonidae. It was first described by Constantin Wesmael in 1844.Catalogue of Life

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyjoppa fuscipennis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

13Tmostly conserved

14Cmostly conserved

22Tmostly conserved

46Tmostly conserved

59Amostly conserved

68Tmostly conserved

76Amostly conserved

79Tmostly conserved

88Amostly conserved

92Cmostly conserved

97Tmostly conserved

131Amostly conserved

154Tmostly conserved

181Amostly conserved

190Gmostly conserved

202Tmostly conserved

205Tmostly conserved

211Amostly conserved

212Amostly conserved

214Tmostly conserved

220Tmostly conserved

223Cmostly conserved

235Cmostly conserved

238Cmostly conserved

259Tmostly conserved

283Tmostly conserved

284Tmostly conserved

286Amostly conserved

304Cmostly conserved

317Gmostly conserved

343Amostly conserved

346Tmostly conserved

349Tmostly conserved

363Gmostly conserved

364Tmostly conserved

374Tmostly conserved

380Amostly conserved

389Amostly conserved

400Tmostly conserved

418Amostly conserved

421Amostly conserved

438Tmostly conserved

458Amostly conserved

460Tmostly conserved

467Cmostly conserved

469Cmostly conserved

472Cmostly conserved

473Tmostly conserved

480Tmostly conserved

486Cmostly conserved

487Tmostly conserved

499Cmostly conserved

506Tmostly conserved

508Cmostly conserved

514Amostly conserved

520Tmostly conserved

526Amostly conserved

539Tmostly conserved

562Tmostly conserved

565Tmostly conserved

568Amostly conserved

586Tmostly conserved

595Cmostly conserved

607Tmostly conserved

610Cmostly conserved

616Cvariable

618Cmostly conserved

619Avariable

620Tmostly conserved

622Amostly conserved

628Amostly conserved

631Amostly conserved

634Cmostly conserved

640Tmostly conserved

646Tmostly conserved

652Cmostly conserved

AATTTTATATTTTCTATTTGGTATATGATCAGGAATAATTGGATCTTCAATAAGAATAATTATTCGATTAGAATTAGGTAATCCTGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes5

BINs2

Most divergent pair9.9%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyjoppa proteussame genus7.1%Coelichneumon cretatussame family8.5%Coelichneumon leucocerussame family8.8%Coelichneumon maurussame family8.9%Naenaria segmentaliasame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amblyjoppa fuscipennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈278 515 835 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amblyjoppa fuscipennis0.28 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type623 records

Wild obs. + sensor473

Museum / vouchered141

Other9

Range

Area of Occupancy AOO1 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 167≤1 km 96≤10 km 154>10 km 2

419 georeferenced · 54 without coordinates

Open the mapobservation + sensor473

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 37≤1 km 37≤10 km 18>10 km 3

95 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	34
MZLUlocation not on record	22
Provincia di Livornolocation not on record	19
NHMOlocation not on record	18
SLU Artdatabankenlocation not on record	18
NCMGlocation not on record	9
Bavarian State Collection of Zoologylocation not on record	8
neflocation not on record	4
Natural History Museum Rotterdamlocation not on record	2
South Kensington, GB	2
BioFokuslocation not on record	1
Tromsø, NO	1
Swedish Museum of Natural Historylocation not on record	1

13 institutions · 139 of 141 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Amblyjoppa fuscipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

border between mixed pine forest and open gr…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 13.9–13.9

Seasonal swing summer↔winter17.6 °C

Max temp (day)16.9 °C

Min temp (night)11.0 °C

Precipitation38.7 mm/mo

Air humidity59.7 %

Moisture balance-86.0 mm/mo

Vapour deficit640 Pa

Wind speed3.00 m/s

Cloud cover39.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)