Amblyglyphidodon flavilatus

Allen & Randall, 1980 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Pomacentridae/Amblyglyphidodon

At a glance

Occurrence records216

Data sources8

Biological traits6

DNA specimens9

eDNA detections10

Sources8 archives

Databases and archives Amblyglyphidodon flavilatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

OBISOcean Biodiversity Information System13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS216 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

Amblyglyphidodon flavilatus, known as yellow damselfish, yellowfin damselfish, yellow flank damselfish, yellow side damselfish, and yellow-sided Damselfish, is part Pomacentridae, which is a family of ray-finned fish including damselfish and clownfish. This family represents the greatest diversity and abundance of fish species inhabiting coral reefs. They were first discovered in the 1980s by Allen and Randall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max20 m

Depth min12 m

Vulnerability10

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyglyphidodon flavilatus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

58Cmostly conserved

118Tmostly conserved

163Amostly conserved

217Tmostly conserved

340Tmostly conserved

352Gmostly conserved

502Tmostly conserved

602Amostly conserved

654Tmostly conserved

CCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGTACGGCTTTAAGCCTCCTCATTCGAGCAGAACTAAGCCAACCAGGCGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes4

BIN1

Most divergent pair0.61%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyglyphidodon orbicularissame genus4.9%Amblyglyphidodon indicussame genus5.1%Amblyglyphidodon curacaosame genus6.0%Amblyglyphidodon leucogastersame genus6.4%Amblyglyphidodon aureussame genus6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type216 records

Wild obs. + sensor181

Museum / vouchered34

Other1

Range

Area of Occupancy AOO476 km²

Depth

0–200 m sunlit11

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 15 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 54≤1 km 51≤10 km 8>10 km 25

138 georeferenced · 43 without coordinates

Open the mapobservation + sensor181

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	7
Frankfurt am Main	5
Washington, US	2
Paris, FR	2
KAUMMlocation not on record	2
South African Institute for Aquatic Biodiversitylocation not on record	1
Chicago, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

8 institutions · 21 of 34 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Amblyglyphidodon flavilatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 25.4–25.4

Seasonal swing summer↔winter20.7 °C

Max temp (day)30.7 °C

Min temp (night)17.3 °C

Precipitation13.0 mm/mo

Air humidity36.6 %

Moisture balance-181 mm/mo

Vapour deficit2,329 Pa

Wind speed5.00 m/s

Cloud cover12.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)