Amblycorypha oblongifolia

(De Geer, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Tettigoniidae/Amblycorypha

At a glance

Occurrence records1 471

Data sources7

Biological traits0

DNA specimens11

eDNA detections13

Sources7 archives

Databases and archives Amblycorypha oblongifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 471 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 471 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD11 specimens

01Narrative

Amblycorypha oblongifolia, the oblong-winged katydid, is a species of insect of the family Tettigoniidae (katydids or bush-crickets).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblycorypha oblongifolia has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

88Cmostly conserved

346Tmostly conserved

400Tmostly conserved

415Gmostly conserved

460Cmostly conserved

519Cmostly conserved

554Gmostly conserved

622Tmostly conserved

AACACTGTACTTCATCTTTGGAGCATGAGCAGGAATAGTAGGAACATCCCTCAGACTTTTAATTCGAGCTGAATTAGGTCAACCCGGCTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes5

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblycorypha floridanasame genus8.5%Myolepta dubiasame order16.3%Leuctra pseudosigniferasame order16.7%Crumomyia setitibialissame order17.0%Oenochroa lactellasame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 471 records

Wild obs. + sensor1 269

Museum / vouchered202

Origin

Native3

Range

Area of Occupancy AOO4 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 730≤1 km 177≤10 km 62>10 km 114

1 083 georeferenced · 186 without coordinates

Open the mapobservation + sensor1 269

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 2≤1 km 8≤10 km 31>10 km 9

50 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	64
	34
Cleveland Museum of Natural History, OH (CLEV)location not on record	27
Champaign, US	24
Wuzhou, CN	19
Provo, US	6
Vancouver, CA	4
CUlocation not on record	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	4
Colorado State Universitylocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
University of Alabamalocation not on record	2
Chicago, US	1
Montgomery, US	1
Saint John, CA	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
University Park, US	1

17 institutions · 198 of 202 vouchered records shown · 4 without an institution code

09Environmental DNA13 detections

Where the DNA of Amblycorypha oblongifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

ForestMixed habitatWetlandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 16.1–23.4

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.2 °C 21.5–28.7

Min temp (night)19.9 °C 12.7–20.8

Precipitation94.8 mm/mo 89.2–114

Air humidity58.0 % 57.9–59.8

Moisture balance-91.5 mm/mo -97.2–-4.60

Vapour deficit1,086 Pa 763–1,213

Wind speed5.30 m/s 2.60–6.10

Cloud cover39.2 % 36.2–45.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amblycorypha oblongifolia

At a glance

Sources7 archives

At a glance

Record type1 471 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 471 records