Amblycirrhitus unimacula

(Kamohara, 1957) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cirrhitidae/Amblycirrhitus

At a glance

Occurrence records58

Data sources8

Biological traits4

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Amblycirrhitus unimacula's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

OBISOcean Biodiversity Information System21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS58 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

De peddelsnuitdraakvis is een vis uit de familie langneusdraakvissen (Rhinochimaeridae). De soort komt voor in de Indische Oceaan en Grote Oceaan op diepten tussen de 500-1500 m. De soort kan een maximale lengte bereiken van 150 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length8.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblycirrhitus unimacula has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

625Avariable

CCTATACCTAGTGTTCGGTGCTTGAGCTGGGATGGTAGGCACAGCCCTGAGCCTTCTTATTCGGGCAGAGCTAAGCCAACCAGGTGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Isocirrhitus sexfasciatussame family10.8%Amblycirrhitus bimaculasame genus14.7%Naso tonganussame order16.2%Naso lopezisame order16.3%Thunnus orientalissame order16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type58 records

Museum / vouchered58

Range

Area of Occupancy AOO80 km²

Depth

0–200 m sunlit15

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 11 m · 15 records with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence58

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	27
Chicago, US	2
Honolulu, US	1
Kagoshima University Museumlocation not on record	1

4 institutions · 31 of 58 vouchered records shown · 6 without an institution code

09Environmental DNA4 detections

Where the DNA of Amblycirrhitus unimacula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 24.6–24.7

Seasonal swing summer↔winter4.40 °C

Max temp (day)25.4 °C 25.2–25.4

Min temp (night)24.1 °C 23.9–24.1

Precipitation158 mm/mo 158–165

Air humidity61.6 % 61.4–61.6

Vapour deficit1,193 Pa 1,188–1,193

Cloud cover31.2 % 30.8–31.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)