Ambigolimax valentianus

(A.Férussac, 1821) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Limacidae/Ambigolimax

At a glance

Occurrence records22 065

Data sources6

Biological traits0

DNA specimens50

eDNA detections9

Sources6 archives

Databases and archives Ambigolimax valentianus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 065 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF22 065 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD50 specimens

01Narrative

Ambigolimax valentianus è un mollusco gasteropode polmonato della famiglia Limacidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ambigolimax valentianus has left across the world's sequence archives.

At a glance

DNA specimens50

BINs2

Marker genes4

eDNA detections9

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P612 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 102 variable positions, in barcode order

1Tmostly conserved

2Tmostly conserved

3Tmostly conserved

5Gmostly conserved

6Amostly conserved

7Gmostly conserved

8Tmostly conserved

9Avariable

12Gvariable

13Tmostly conserved

15Tmostly conserved

16Gmostly conserved

17Gmostly conserved

18Gvariable

19Amostly conserved

21Amostly conserved

23Tmostly conserved

24Gmostly conserved

25Gmostly conserved

26Gmostly conserved

27Gmostly conserved

28Amostly conserved

29Cmostly conserved

30Amostly conserved

31Gmostly conserved

32Gmostly conserved

35Tmostly conserved

36Amostly conserved

38Cmostly conserved

39Tmostly conserved

40Tmostly conserved

43Tmostly conserved

45Amostly conserved

46Amostly conserved

47Tmostly conserved

48Tmostly conserved

50Gmostly conserved

51Amostly conserved

52Cmostly conserved

53Tmostly conserved

54Amostly conserved

55Gmostly conserved

56Amostly conserved

57Amostly conserved

58Cmostly conserved

59Tmostly conserved

60Tmostly conserved

61Gmostly conserved

62Gmostly conserved

63Gvariable

64Amostly conserved

66Amostly conserved

68Cmostly conserved

71Gmostly conserved

72Tmostly conserved

73Gmostly conserved

75Tmostly conserved

76Tmostly conserved

79Tmostly conserved

95Tmostly conserved

126Amostly conserved

144Amostly conserved

162Amostly conserved

165Gmostly conserved

171Amostly conserved

183Cmostly conserved

186Amostly conserved

187Cmostly conserved

189Tmostly conserved

201Cmostly conserved

204Cmostly conserved

210Avariable

243Amostly conserved

246Amostly conserved

252Gmostly conserved

255Gmostly conserved

294Tmostly conserved

303Avariable

309Gmostly conserved

318Amostly conserved

321Cvariable

336Cmostly conserved

339Tmostly conserved

367Cmostly conserved

393Gmostly conserved

411Gmostly conserved

450Cmostly conserved

459Gmostly conserved

462Gmostly conserved

465Amostly conserved

522Tmostly conserved

523Tmostly conserved

528Gvariable

531Tmostly conserved

537Tmostly conserved

546Gmostly conserved

561Gmostly conserved

573Tmostly conserved

594Cvariable

600Amostly conserved

603Gmostly conserved

606Amostly conserved

TTTGGAGTATGGTGTGGGATAGTGGGGACAGGATTATCTTTATTAATTCGACTAGAACTTGGGACAGCTGGTGTTTTATTAGATGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.4%

Haplotypes9

BINs2

Most divergent pair16.8%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ambigolimax parvipenissame genus6.8%Limacus flavussame family12.7%Limacus maculatussame family13.0%Aegopinella epipedostomasame order13.0%Bielzia coerulanssame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_072954 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ND6ND5ND1ND4LCYTBCOX2ATP8ATP6ND3ND4COX3ND2rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type22 065 records

Wild obs. + sensor21 783

Museum / vouchered282

Origin

Native6

Introduced13

Range

Area of Occupancy AOO23 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 13 195≤1 km 3 118≤10 km 3 826>10 km 109

20 248 georeferenced · 1 535 without coordinates

Open the mapobservation + sensor21 783

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 21≤1 km 28≤10 km 10>10 km 7

66 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence282

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gothenburg, SE	95
Los Angeles, US	35
Santa Barbara Museum of Natural Historylocation not on record	24
Helsinki, FI	19
Natick, US	18
Bern, CH	9
SLU Artdatabankenlocation not on record	9
Toyohashi Museum Of Natural Historylocation not on record	6
Paris, FR	4
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	4
Tasmanian Museum & Art Gallerylocation not on record	4
Salzburg, AT	3
Bavarian State Collection of Zoologylocation not on record	3
EL PASO, US	2
Chongqing Museumlocation not on record	2
Chicago, US	2
DASSHlocation not on record	1

17 institutions · 240 of 282 vouchered records shown · 41 without an institution code

09Environmental DNA9 detections

Where the DNA of Ambigolimax valentianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 5.40–13.7

Seasonal swing summer↔winter18.6 °C

Max temp (day)15.5 °C 8.80–18.1

Min temp (night)5.70 °C 1.00–8.50

Precipitation93.0 mm/mo 70.9–190

Air humidity58.3 % 57.9–59.9

Moisture balance-14.3 mm/mo -22.0–141

Vapour deficit557 Pa 368–659

Wind speed2.50 m/s 1.90–3.20

Cloud cover36.8 % 34.4–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ambigolimax valentianus

At a glance

Sources6 archives

At a glance

Record type22 065 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type22 065 records