Ambassis kopsii

Bleeker, 1858 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Ambassidae/Ambassis

At a glance

Occurrence records385

Data sources8

Biological traits7

DNA specimens21

eDNA detections0

Sources8 archives

Databases and archives Ambassis kopsii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility288 records↗

OBISOcean Biodiversity Information System97 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS385 records

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT · NCBI≈628 Mbp

01Narrative

Ambassis kopsii is een straalvinnige vissensoort uit de familie van Aziatische glasbaarzen (Ambassidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1858 door Bleeker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10.2 cm

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability19.44

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ambassis kopsii has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

78Amostly conserved

165Tmostly conserved

249Amostly conserved

280Tmostly conserved

309Gmostly conserved

333Gmostly conserved

393Tmostly conserved

498Gmostly conserved

607Tmostly conserved

612Tmostly conserved

633Cmostly conserved

CTTTATCTAGTATTCGGTGCTTGAGCCGGCATAGTTGGAACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAAGCCAACCAGGCTCTCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes5

BIN1

Most divergent pair1.2%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ambassis naluasame genus14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ambassis kopsii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈628 245 299 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ambassis kopsii0.63 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type385 records

Wild obs. + sensor228

Museum / vouchered156

Other1

Origin

Native7

Range

Area of Occupancy AOO432 km²

Depth

0–200 m sunlit16

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 5 m · 16 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 57≤1 km 64≤10 km 38>10 km 7

166 georeferenced · 62 without coordinates

Open the mapobservation + sensor228

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 8≤1 km 20≤10 km 37>10 km 24

89 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence156

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	21
Washington, US	11
Mutare Museumlocation not on record	10
Louisiana State University, Museum of Zoologylocation not on record	7
Ann Arbor, US	5
Fisheries Research Laboratory, Mie Universitylocation not on record	3
Frankfurt am Main	3
Chicago, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Toronto, CA	2
Paris, FR	1
Vancouver, CA	1
Kagoshima University Museumlocation not on record	1

13 institutions · 70 of 156 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)