Amazona leucocephala

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Amazona

At a glance

Occurrence records15 700

Data sources12

Biological traits24

DNA specimens11

eDNA detections11

Sources12 archives

Databases and archives Amazona leucocephala's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 700 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF15 700 records

Environmental DNA1 datasets · 0 countries11 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · NCBI1.6 Gbp

01Narrative

The Cuban amazon (Amazona leucocephala) also known as Cuban parrot or the rose-throated parrot, is a medium-sized mainly green parrot found in woodlands and dry forests of Cuba, the Bahamas and Cayman Islands in the Caribbean. Although they have been observed in the wild in Puerto Rico, they are probably the result of escaped pets, and no reproduction has been recorded.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAnAgeAmnioteDBAVONET

Size & morphology12

Beak depth27.3 mm

Beak length (culmen)30.2 mm

Beak length (nares)24.6 mm

Beak width15.6 mm

Body mass236 g

Hand-wing index33.8

Kipp's distance67 mm

SVL32 cm

Secondary length132 mm

Tail length113 mm

Tarsus length20.9 mm

Wing length199 mm

Life cycle & reproduction1

Litter size3.75

Diet & foraging7

Canopy40 %

Fruit40 %

Midhigh60 %

Plant other30 %

Seed30 %

Trophic levelherbivore

Trophic nicheOmnivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size31 233 km²

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amazona leucocephala has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes2

eDNA detections11

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 548 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 121 variable positions, in barcode order

51Cmostly conserved

69Tmostly conserved

99Amostly conserved

102Cmostly conserved

103Cmostly conserved

111Cmostly conserved

120Amostly conserved

123Cmostly conserved

138Tmostly conserved

144Cmostly conserved

150Tmostly conserved

189Tmostly conserved

213Avariable

219Tvariable

222Gmostly conserved

228Amostly conserved

231Amostly conserved

234Tmostly conserved

247Gmostly conserved

300Gmostly conserved

310Cmostly conserved

333Cmostly conserved

339Avariable

348Tmostly conserved

357Amostly conserved

365Tmostly conserved

366Avariable

375Gmostly conserved

378Gvariable

396Amostly conserved

411Cmostly conserved

432Tmostly conserved

435Gmostly conserved

441Cmostly conserved

471Tmostly conserved

480Amostly conserved

492Tmostly conserved

498Cmostly conserved

519Gmostly conserved

525Tmostly conserved

528Gmostly conserved

546Amostly conserved

582Amostly conserved

591Tmostly conserved

609Cmostly conserved

612Cmostly conserved

666Tvariable

672Amostly conserved

688Tmostly conserved

696Amostly conserved

717Amostly conserved

738Cmostly conserved

744Gmostly conserved

747Amostly conserved

753Tvariable

768Tmostly conserved

771Amostly conserved

798Avariable

801Amostly conserved

810Tmostly conserved

816Tmostly conserved

819Amostly conserved

822Amostly conserved

825Amostly conserved

828Tmostly conserved

831Gmostly conserved

834Amostly conserved

840Tmostly conserved

915Cmostly conserved

918Amostly conserved

921Tmostly conserved

942Cmostly conserved

948Cmostly conserved

972Tmostly conserved

978Cmostly conserved

990Amostly conserved

1012Cmostly conserved

1020Amostly conserved

1029Amostly conserved

1044Cmostly conserved

1048Amostly conserved

1056Cmostly conserved

1059Tmostly conserved

1062Amostly conserved

1065Amostly conserved

1092Cmostly conserved

1101Amostly conserved

1116Cmostly conserved

1128Cmostly conserved

1140Tvariable

1155Tmostly conserved

1161Cmostly conserved

1173Cmostly conserved

1203Tmostly conserved

1206Gvariable

1209Cvariable

1213Tmostly conserved

1227Gmostly conserved

1230Cmostly conserved

1233Amostly conserved

1245Amostly conserved

1248Tmostly conserved

1254Tmostly conserved

1305Cmostly conserved

1335Tmostly conserved

1357Cmostly conserved

1365Cmostly conserved

1368Tmostly conserved

1374Amostly conserved

1413Tmostly conserved

1434Cmostly conserved

1443Amostly conserved

1453Tvariable

1458Cmostly conserved

1464Tmostly conserved

1470Cmostly conserved

1473Cmostly conserved

1474Amostly conserved

1497Gmostly conserved

1500Cmostly conserved

+1 more variable positions not shown

GTGACCACAACCCGATGACTATTCTCAACCAACCACAAAGACATTGGCACCCTTTACCTAATTTTCGGTGCATGAGCTGGCATAATTGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes7

BINs0

Most divergent pair6.8%

OtherN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082164 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S16S

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amazona leucocephala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 579 470 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amazona leucocephala1.58 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type15 700 records

Wild obs. + sensor15 642

Museum / vouchered21

Fossil37

Origin

Native70

Range

Area of Occupancy AOO3 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 76≤1 km 10≤10 km 1>10 km 132

219 georeferenced · 15 423 without coordinates

Open the mapobservation + sensor15 642

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 1≤10 km 7>10 km 1

9 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	5
Washington, US	5
Ohio State University - Bird Division, Columbus, OH (OSUM)location not on record	2
Seattle, US	2
Ann Arbor, US	2
Iowa City, US	1
Geneva, CH	1
University of Nebraska State Museumlocation not on record	1
München, DE	1
Musée des Confluenceslocation not on record	1

10 institutions · 21 of 21 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Amazona leucocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amazona leucocephala

At a glance

Sources12 archives

Size & morphology12

Life cycle & reproduction1

Diet & foraging7

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type15 700 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type15 700 records